Menu
Your Cart
Solicite sus oligos online, al mejor precio y tiempo de entrega 48 hs Click here

Genbiotech

Brand: Genbiotech Model: L00607
Marker A consists of six DNA fragments ranging from 100 to 1200bp and is supplied in loading buffer containing tracking dye and precipitant for agarose gel electrophoresis, which is in a convenient ready-to-load format. The recommended volume for each lane is 6ul, and the amount of 700bp is about 10..
$85.00
Brand: Genbiotech Model: RU1309
STRUCTURE: CH2=CH-CO-NH2CAS NUMBER: 79-06-1SYNONYM: 2-propenamideAppearance: White powder Molecular formula: C3H5NO Molecular weight: 71.08 Melting point: 84.5 °C,although stable in the dark, it readily polymerizes at its melting point, in solution or under ultraviolet light.1 Special tests: D..
$79.85
Brand: Genbiotech Model: RU1007
MOLECULAR FORMULA: C24H38O19CAS NUMBER: 9012-36-6Appearance: White powderImpurities: ≤10% moisture contentElectroendosmosis (EEO): 0.09-0.13Melting point: 36 °C (1.5% gel, ± 1.5 °C)Gel Strenght: ≥1200 g/cm2 (1% gel)Special tests: DNase, RNase an..
$90.00
Brand: Genbiotech Model: CRPANRD
RdRP_SARSr-F2 GTGARATGGTCATGTGTGGCGGRdRP_SARSr-R1 CARATGTTAAASACACTATTAGCATARdRP_SARSr-P2 FAM-CAGGTGGAACCTCATCAGGAGATGC-BHQ1(the above probe is specific for 2019-nCoV, will not detect SARS-CoV)..
$375.00
Brand: Genbiotech Model: CRDPANE
E_Sarbeco_F1 ACAGGTACGTTAATAGTTAATAGCGTE_Sarbeco_R2 ATATTGCAGCAGTACGCACACAE_Sarbeco_P1 FAM-ACACTAGCCATCCTTACTGCGCTTCG-BHQ1..
$375.00
Brand: Genbiotech Model: CRPANR
RP-F RNAse P Forward AGATTTGGACCTGCGAGCG RP-R RNAse P Reverse GAGCGGCTGTCTCCACAAGT RP-P RNAse P FAM-TTCTGACCTGAAGGCTCTGCGCG-BHQ1  ..
$375.00
Brand: Genbiotech Model: PE6001
Description:5M solution of betaine in MilliQ H2O. DNase, RNase free.Betaine is a PCR enhancing agent that has been used successfully for increasing yield and specificity of PCR products. It equalizes the contribution of GC- and AT-base pairing to the stability of the DNA duplex. Therefore, it’s very..
$70.00
Brand: Genbiotech Model: RU1110
CAS Number: 10043-35-3Synonyms: boracic acid; orthoboric acidMolecular formula: H3BO3Molecular weight: 61.83Melting point: ~171°C 1Boric acid volatizes in steam. When heated to 100°C, the solid loses water and is slowly converted into metaboric acid (HBO2); tetraboric acid (H2B4O7) is..
$35.74
Brand: Genbiotech Model: PD2004
10 mM dNTPs Mix is a ready-to-use solution of dATP, dCTP, dGTP and dTTP (monosodium salts) at a concentration of 10 mM each in sterile deionized water at pH7.5, whose purity is ≥99% (HPLC). It is free of RNase and DNase, and is suitable for any molecular biology application that requi..
$85.81
Brand: Genbiotech Model: RU3110
Molecular Formula: C2H5NO2 Molecular Weight: 75.07 CAS Number: 56-40-6 Synonyms: aminoacetic acid, aminoethanoic acid, glycocoll1 Abbreviations: Gly, G This product is designated as Electrophoresis grade. It has been tested for use in electrode buffers for polyacrylamide gel electrophoresis ..
$90.02
Brand: Genbiotech Model: RU2207
Guanidine thiocyanate is a freely soluble chaotropic agent routinely used for DNA/RNA extraction protocols.CAS: 593-84-0Molecular Formula: CN3H5 •HSCNMolecular weight: 118.16Form: PowderAppearance: White crystalline powderSolubility: Water: Freely solubleSource: SyntheticAmmonia: Not more than ..
$60.98
Brand: Genbiotech Model: PE4014
Moloney Murine Leukemia Virus (M-MuLV) Reverse Transcriptase is an RNA dependent DNA polymerase. It can synthesize a complementary DNA strand initiating from a primer using either RNA or single-stranded DNA as a template. The absence of RNase H activity enhances the synthesis of long cDN..
$110.00
Brand: Genbiotech Model: LW52
Adapted to A2 pipette pump, Absorb the liquid precisely and fast-release,red color-coded for quick identification, Pipette Pump1pc/Pack Fast-release pipetting device is made expressly for pipets that are calibrated to the tip but not to be blown out (retains final drop)..
$15.00
Brand: Genbiotech Model: RU1025
RNase A is a preparation of bovine pancreatic ribonuclease suitable for use in selective removal of RNA. An essentially protease free, freeze dried powder with an activity of not less than 70 U/mg materialOption 1RNAse A 10 mg/ml:Dissolve the RNase A at a final concentration of 10 mg/ml in..
$68.00
Brand: Genbiotech Model: PE1010
Product Description Cloned Taq DNA Polymerase is expressed and purified from E. coli that carries the Taq DNA Polymerase gene from Thermus aquaticus. Taq DNA polymerase is a thermostable enzyme that catalyzes the polymerization of nucleotides in the 5’-to-3’ direction at 70-74 ºC and exhibit..
$40.00
Showing 145 to 192 of 255 (6 Pages)