Menu
Your Cart
Solicite sus oligos online, al mejor precio y tiempo de entrega 48 hs Click here

RNAzol® BD (100 ml)

RNAzol® BD (100 ml)
RNAzol® BD (100 ml)

RNAzol® BD is the most effective reagent for isolation of total RNA from whole blood, plasma or serum of human or animal origin. This patented reagent(1) employs an improved single-step method to provide the highest yield and purity of isolated RNA. RNAzol® BD isolates pure and undegraded RNA that is ready for RT-PCR without DNase treatment (2).

  • RNAzol® RT isolates total RNA, or large RNA and small RNA in separate fractions. The large RNA fraction contains rRNA and mRNA. The small RNA fraction contains tRNA, small RNA and microRNA down to 10 bases.
  • RNAzol® BD allows for the isolation of RNA and DNA from the same blood sample.
  • The RNA isolation procedure can be completed in 1.5 hours and is performed at room temperature, including centrifugation steps.
  • Typical yields provide 8 – 22 μg total RNA per 1ml of human blood.
  • The isolated RNA is ready for RT-PCR, qRT-PCR, microarrays, poly A+ selection, northern blotting, RNase protection assay and other molecular biology applications.
  • Due to the removal of impurities, the RNA pellets are smaller and solubilize more easily.

RNAzol® BD is used to isolate RNA from whole blood, plasma or serum. One milliliter is sufficient to process 0.5 ml of whole blood.

Download User Manual

Write a review

$291.00
  • Model RB192100
  • Weight: 0.00kg
Betaine Solution 5 M (5 x 1 ml)
Most Viewed
Description:5M solution of betaine in MilliQ H2O. DNase, RNase free.Betaine is a PCR enhancing agent that has been used successfully for increasing yi..
$70.00
GelRed™ 10,000X in water (0.5 ml) GelRed™ 10,000X in water (0.5 ml)
Most Viewed Bestsellers
GelGreen™ is a sensitive, stable and environmentally safe green fluorescent nucleic acid dye designed to stain either dsDNA, ssDNA or RNA in agarose g..
$235.00
RNAzol® BD is the most effective reagent for isolation of total RNA from whole blood, plasma or serum of human or animal origin. This patented reagent..
$291.00
Assay 2 (E_Sarbeco) 1000 rxns
Bestsellers
E_Sarbeco_F1 ACAGGTACGTTAATAGTTAATAGCGTE_Sarbeco_R2 ATATTGCAGCAGTACGCACACAE_Sarbeco_P1 FAM-ACACTAGCCATCCTTACTGCGCTTCG-BHQ1..
$375.00
1 kb DNA ladder (50 ug)
Bestsellers
Serves as molecular weight standards for agarose gel electrophoresis. Suitable for sizing of PCR products or other double-stranded DNA fragments. Frag..
$63.00
100 bp DNA ladder (50 ug)
Bestsellers
Serves as molecular weight standards for electrophoresis for both agarose and polyacrylamide gels. Suitable for sizing of PCR products or other double..
$85.00
UV/Vis Nano Spectrophotometer UV/Vis Nano Spectrophotometer
Bestsellers Special Offers
Nabi- UV/Vis Nano Spectrophotometer is a miniature spectrophotometer that can measure cuvette and microvolume samples. Using spectrometer technology, ..
$14,500.00
TRI Reagent® (100 ml)
Bestsellers
TRI Reagent® is a patented reagent for the isolation of total RNA or for the simultaneous isolation of RNA, DNA and proteins. The reagent is an i..
$283.14
200uL Racked Filtered Vertex Tips, Clear, Graduated, NoStick® (96 tips/rack)
Bestsellers
Features10uL to 1250uLClean Liquid ReleaseGraduatedFree of DNase, RNase, DNA and PCR inhibitorsFiltered tips feature HDPE barrier that won't contamina..
$45.00
96 wells cell culture plate, treated, sterile (individually package) 96 wells cell culture plate, treated, sterile (individually package)
Bestsellers
Sorfa cell culture plates (also named tissue culture plates) are manufactured from raw materials of high transparency polystyrene in four different si..
$1.83
UV/Vis Nano Spectrophotometer UV/Vis Nano Spectrophotometer
Bestsellers Special Offers
Nabi- UV/Vis Nano Spectrophotometer is a miniature spectrophotometer that can measure cuvette and microvolume samples. Using spectrometer technology, ..
$14,500.00