Menu
Your Cart
Solicite sus oligos online, al mejor precio y tiempo de entrega 48 hs Click here

GenMute™ siRNA Transfection Reagent (1.0 ml)

GenMute™ siRNA Transfection Reagent (1.0 ml)
GenMute™ siRNA Transfection Reagent (1.0 ml)

Description:
GenMute™ Reagent is a novel biodegradable non-liposomal siRNA/miRNA & DNA delivery tool. With our proprietary pH Dependent Conformational Change (PDCC) technology, the biodegradable transfection reagent was formulated by addition of pre-screened hydrophobic groups to its side chain, making GenMute™ Reagent a versatile and most powerful gene delivery tool in the market. GenMute™ Reagent have been validated to effectively and reproducibly transfect single siRNA/miRNA or co-transfect DNA/siRNA or DNA/miRNA to variety of mammalian cells.

Size & content:
- GenMute™ Reagent, 1.0 mL, sufficient for ~2,000 reactions based on transfecting 5.0 pmol siRNA or miRNA mimics in 24-well plate.
- GenMute™ Transfection Buffer (5x ), formulated for maximal transfection efficiency, 8.0 mL to make 40 mL working solution.

Applications:
- Single siRNA transfection or DNA/siRNA co-transfection to variety of mammalian cells.
- Single miRNA, miRNA mimics or inhibitors transfection or DNA/miRNA or DNA/miRNA mimics co-transfection to variety of mammalian cells.

Storage:
Store at 4 °C for GenMute™ Reagent and RT for GenMute™ Transfection Buffer (5x ).  If stored properly, the product is stable for 12 months or longer.

Advantages: 
- Excellent silencing at low concentrations with only 1.0 nM siRNA / miRNA mimics
- Minimizing non-specific and off target effects in the cell 
- One tube reaction
- Best for broad mammalian cells
- Very low cytotoxicity
- Very affordable

Comparisons of Silencing Efficacy of GenMute™ siRNA & DNA Transfection Reagent with Brand Name Products
GenMute_vs_Dharmafect_Lipo2000

Knockdown efficacy comparison of GenMute™ Transfection Reagent (upper panel) vs. Dharmafect™ 4 siRNA Transfection Reagent (middle panel) and Lipofectamine™ 2000 (lower panel) on HEK293 cells. siRNA targeting renilla luciferase at different final concentrations ranging from 0.5 to 20 nM was co-transfected with renilla luciferase gene (0.5 µg of pRL-CMV DNA per well) by the above three transfection reagents per manufacturers' protocols into HEK293 cells growing on a 24-well plate. Renilla luciferase activity was determined 24h after post co-transfection with renilla luciferase determination system (Promega). The luminescence was measured from 5.0 µl of lysate during 10s integration with a luminometer (Beckman Coulter LD 400). Luciferase activity was expressed as light units integrated over 10s (RLU) and normalized per mg of cell protein by using the BCA assay. The errors bars represent standard deviation derived from triplicate experiments. Luciferase-silencing efficiency was calculated relative to untreated cells. While GenMute™ and Dharmafect™ 4 reagents delivered significant gene silencing from 1.0 nM of renilla luciferase siRNA, lipofectamine™ 2000 gave good knockdown only after 30 nM (data not shown).

GenMute_EG5_siRNA_HEK293
Excellent silencing of endogenously expressed KIF11 (also known as Eg5) in HEK293 cells with 0.5 µl of GenMute™ reagent and 5.0 pmol Eg5 siRNA per well of 24-well plate. KIF11 (also known as Eg5) encodes a motor protein that belongs to the kinesin-like protein family involved in chromosome positioning and bipolar spindle formation during cell mitosis. A reduction in KIF11 levels causes mitotic arrest. GenMute™ reagent effectively delivers Eg5 siRNA (final 10 nM, right panel) to HEK293 cells at only 0.5 µl per well of 24-well plate vs. negative control (final 10 nM. left panel). Compared with negative control (left panel), phenotype of "rounded-up" 293 cells were visualized 24 hours post transfection (right panel) with a Nikon microscope. 

GenMute_Lamin_siRNA_Hela
GenMute™ Transfection Reagent knocked down endogenous lamin A/C gene expression in Hela cells. A siRNA targeting lamin A/C gene (right panel) and a sham siRNA (left panel) were introduced into Hela cells (final 1.0 nM) by GenMute™ Transfection Reagent. Lamin A/C gene silencing was monitored 24h post transfection by immunofluorescence. Lamin A/C was probed with a mouse monoclonal lamin A/C specific antibody followed by addition of FITC-conjugated anti-mouse antibodies. Quantitative analysis showed that lamin siRNA at 1.0 nM delivered by GenMute™ Transfection Reagent knocked down 94% endogenously expressed lamin A/C in Hela cells.

Transfection
Formulation pH Dependent Conformational Change
tooo ++

Write a review

$598.00
  • Model SL100568
  • Weight: 0.00kg
Betaine Solution 5 M (5 x 1 ml)
Most Viewed
Description:5M solution of betaine in MilliQ H2O. DNase, RNase free.Betaine is a PCR enhancing agent that has been used successfully for increasing yi..
$70.00
GelRed™ 10,000X in water (0.5 ml) GelRed™ 10,000X in water (0.5 ml)
Most Viewed Bestsellers
GelGreen™ is a sensitive, stable and environmentally safe green fluorescent nucleic acid dye designed to stain either dsDNA, ssDNA or RNA in agarose g..
$235.00
Description:GenMute™ Reagent is a novel biodegradable non-liposomal siRNA/miRNA & DNA delivery tool. With our proprietary pH Dependent Confor..
$598.00
MOPS (100 g)
Bestsellers
Chemical Name : 3-(N-Morpholino)-Propanesulfonic AcidCAS: 1132-61-2Molecular Formula : C7H15NO4SMolecular Weight : 209.3 Structure : &n..
$94.38
Assay 2 (E_Sarbeco) 1000 rxns
Bestsellers
E_Sarbeco_F1 ACAGGTACGTTAATAGTTAATAGCGTE_Sarbeco_R2 ATATTGCAGCAGTACGCACACAE_Sarbeco_P1 FAM-ACACTAGCCATCCTTACTGCGCTTCG-BHQ1..
$375.00
Description:Based on our innovative and proprietary lipid-conjugation technology, LipoJet™ Transfection Kit, formulated from novel fluorinated ca..
$995.00
1 kb DNA ladder (50 ug)
Bestsellers
Serves as molecular weight standards for agarose gel electrophoresis. Suitable for sizing of PCR products or other double-stranded DNA fragments. Frag..
$63.00
100 bp DNA ladder (50 ug)
Bestsellers
Serves as molecular weight standards for electrophoresis for both agarose and polyacrylamide gels. Suitable for sizing of PCR products or other double..
$85.00
UV/Vis Nano Spectrophotometer UV/Vis Nano Spectrophotometer
Bestsellers Special Offers
Nabi- UV/Vis Nano Spectrophotometer is a miniature spectrophotometer that can measure cuvette and microvolume samples. Using spectrometer technology, ..
$14,500.00
Assay 1 (RdRRP) 1000 rxns
Bestsellers
RdRP_SARSr-F2 GTGARATGGTCATGTGTGGCGGRdRP_SARSr-R1 CARATGTTAAASACACTATTAGCATARdRP_SARSr-P2 FAM-CAGGTGGAACCTCATCAGGAGATGC-BHQ1(the above ..
$375.00
200uL Racked Filtered Vertex Tips, Clear, Graduated, NoStick® (96 tips/rack)
Bestsellers
Features10uL to 1250uLClean Liquid ReleaseGraduatedFree of DNase, RNase, DNA and PCR inhibitorsFiltered tips feature HDPE barrier that won't contamina..
$45.00
1mL Racked Filtered Vertex Tips, Clear, Graduated, NoStick® (96 tips/rack)
Bestsellers
Features10uL to 1250uLClean Liquid ReleaseGraduatedFree of DNase, RNase, DNA and PCR inhibitorsFiltered tips feature HDPE barrier that won't contamina..
$35.00
UV/Vis Nano Spectrophotometer UV/Vis Nano Spectrophotometer
Bestsellers Special Offers
Nabi- UV/Vis Nano Spectrophotometer is a miniature spectrophotometer that can measure cuvette and microvolume samples. Using spectrometer technology, ..
$14,500.00