Menu
Your Cart
Solicite sus oligos online, al mejor precio y tiempo de entrega 48 hs Click here

BIO-HEMATO™ Medium, with conditioned medium 100 ml

BIO-HEMATO™ Medium, with conditioned medium 100 ml
BIO-HEMATO™ Medium, with conditioned medium 100 ml
Bone Marrow and Peripheral Blood Hematopoietic Cell Culture Media

Cytogenetic analysis of human hematopoietic cells using bone marrow aspirates is a standard practice in hematology. Fresh cells or cells grown in short-term cultures often yield an insufficient number of mitotic cells and repeated aspirations are required. Hematopoietic Cell Karyotyping Medium was developed to stimulate the proliferation of human hematopoietic cells from bone marrow as well as from peripheral blood.

This medium is particularly effective for karyotyping of acute non-lymphocytic leukemias and various stages of chronic myelogenous leukemia, as well as other hematological disorders such as myelodysplastic syndrome and polycythemia vera.

Download User Manual

Write a review

$199.65
  • Model 01-200-1B
  • Weight: 0.00kg
Betaine Solution 5 M (5 x 1 ml)
Most Viewed
Description:5M solution of betaine in MilliQ H2O. DNase, RNase free.Betaine is a PCR enhancing agent that has been used successfully for increasing yi..
$70.00
GelRed™ 10,000X in water (0.5 ml) GelRed™ 10,000X in water (0.5 ml)
Most Viewed Bestsellers
GelGreen™ is a sensitive, stable and environmentally safe green fluorescent nucleic acid dye designed to stain either dsDNA, ssDNA or RNA in agarose g..
$235.00
Bone Marrow and Peripheral Blood Hematopoietic Cell Culture MediaCytogenetic analysis of human hematopoietic cells using bone marrow aspirates is a st..
$199.65
BIO-AMF™-3 Complete Medium (100 ml)
Bestsellers
BIOAMF™-3 Complete Medium is a is a further optimized, fully supplemented medium featuring an enhanced buffering system, improved banding quality, inc..
$101.64
Assay 3 (RNAse P) 1000 rxns
Bestsellers
RP-F RNAse P Forward AGATTTGGACCTGCGAGCG RP-R RNAse P Reverse GAGCGGCTGTCTCCACAAGT RP-P RNAse P FAM-TTCTGACCTGAAGGCTCTGCGCG-BHQ1  ..
$375.00
1 kb DNA ladder (50 ug)
Bestsellers
Serves as molecular weight standards for agarose gel electrophoresis. Suitable for sizing of PCR products or other double-stranded DNA fragments. Frag..
$63.00
100 bp DNA ladder (50 ug)
Bestsellers
Serves as molecular weight standards for electrophoresis for both agarose and polyacrylamide gels. Suitable for sizing of PCR products or other double..
$85.00
UV/Vis Nano Spectrophotometer UV/Vis Nano Spectrophotometer
Bestsellers Special Offers
Nabi- UV/Vis Nano Spectrophotometer is a miniature spectrophotometer that can measure cuvette and microvolume samples. Using spectrometer technology, ..
$14,500.00
Assay 1 (RdRRP) 1000 rxns
Bestsellers
RdRP_SARSr-F2 GTGARATGGTCATGTGTGGCGGRdRP_SARSr-R1 CARATGTTAAASACACTATTAGCATARdRP_SARSr-P2 FAM-CAGGTGGAACCTCATCAGGAGATGC-BHQ1(the above ..
$375.00
200uL Racked Filtered Vertex Tips, Clear, Graduated, NoStick® (96 tips/rack)
Bestsellers
Features10uL to 1250uLClean Liquid ReleaseGraduatedFree of DNase, RNase, DNA and PCR inhibitorsFiltered tips feature HDPE barrier that won't contamina..
$45.00
1mL Racked Filtered Vertex Tips, Clear, Graduated, NoStick® (96 tips/rack)
Bestsellers
Features10uL to 1250uLClean Liquid ReleaseGraduatedFree of DNase, RNase, DNA and PCR inhibitorsFiltered tips feature HDPE barrier that won't contamina..
$35.00
UV/Vis Nano Spectrophotometer UV/Vis Nano Spectrophotometer
Bestsellers Special Offers
Nabi- UV/Vis Nano Spectrophotometer is a miniature spectrophotometer that can measure cuvette and microvolume samples. Using spectrometer technology, ..
$14,500.00