Menu
Your Cart
Solicite sus oligos online, al mejor precio y tiempo de entrega 48 hs Click here

BIO-AMF™-2 Medium (500 ml)

BIO-AMF™-2 Medium (500 ml)
BIO-AMF™-2 Medium (500 ml)

BIOAMF™-2 Complete Medium is a fully-supplemented medium optimized for the primary culture of human amniotic fluid and chorionic villi cells for cytogenetic studies.

Features

  • Ready-to-use We offer a single bottle formulation, complete with L-Glutamine and Gentamycin, which is shipped frozen. Upon receipt, simply thaw and use. We recommend storing thawed medium at 2-8°C for up to seven days.
  • Quality and performance testing BIOAMF-2 Complete Medium is evaluated for cell growth using primary human amniotic fluid cells from a leading clinical cytogenetics laboratory. Additionally we test each batch for sterility, pH, osmolality and endotoxin concentrations.
  • Optimized and complete solution BIOAMF™-2 Complete Medium is prepared with Fetal Bovine Serum (FBS), L-Glutamine and Gentamycin optimized for both open (CO2) and closed systems.

    cGMP Manufacturing and Quality System BIOAMF™-2 Complete Medium is manufactured at our cGMP compliant facility, located in Beit Haemek, Israel. The facility is registered with the FDA as a medical device manufacturer and is certified to ISO 13485 standards.

Write a review

$356.00
  • Model 01-194-1A
  • Weight: 0.00kg
Betaine Solution 5 M (5 x 1 ml)
Most Viewed
Description:5M solution of betaine in MilliQ H2O. DNase, RNase free.Betaine is a PCR enhancing agent that has been used successfully for increasing yi..
$70.00
GelRed™ 10,000X in water (0.5 ml) GelRed™ 10,000X in water (0.5 ml)
Most Viewed Bestsellers
GelGreen™ is a sensitive, stable and environmentally safe green fluorescent nucleic acid dye designed to stain either dsDNA, ssDNA or RNA in agarose g..
$235.00
BIOAMF™-2 Complete Medium is a fully-supplemented medium optimized for the primary culture of human amniotic fluid and chorionic villi cells for cytog..
$356.00
BIO-AMF™-3 Complete Medium (100 ml)
Bestsellers
BIOAMF™-3 Complete Medium is a is a further optimized, fully supplemented medium featuring an enhanced buffering system, improved banding quality, inc..
$101.64
Assay 3 (RNAse P) 1000 rxns
Bestsellers
RP-F RNAse P Forward AGATTTGGACCTGCGAGCG RP-R RNAse P Reverse GAGCGGCTGTCTCCACAAGT RP-P RNAse P FAM-TTCTGACCTGAAGGCTCTGCGCG-BHQ1  ..
$375.00
1 kb DNA ladder (50 ug)
Bestsellers
Serves as molecular weight standards for agarose gel electrophoresis. Suitable for sizing of PCR products or other double-stranded DNA fragments. Frag..
$63.00
100 bp DNA ladder (50 ug)
Bestsellers
Serves as molecular weight standards for electrophoresis for both agarose and polyacrylamide gels. Suitable for sizing of PCR products or other double..
$85.00
UV/Vis Nano Spectrophotometer UV/Vis Nano Spectrophotometer
Bestsellers Special Offers
Nabi- UV/Vis Nano Spectrophotometer is a miniature spectrophotometer that can measure cuvette and microvolume samples. Using spectrometer technology, ..
$14,500.00
Assay 1 (RdRRP) 1000 rxns
Bestsellers
RdRP_SARSr-F2 GTGARATGGTCATGTGTGGCGGRdRP_SARSr-R1 CARATGTTAAASACACTATTAGCATARdRP_SARSr-P2 FAM-CAGGTGGAACCTCATCAGGAGATGC-BHQ1(the above ..
$375.00
200uL Racked Filtered Vertex Tips, Clear, Graduated, NoStick® (96 tips/rack)
Bestsellers
Features10uL to 1250uLClean Liquid ReleaseGraduatedFree of DNase, RNase, DNA and PCR inhibitorsFiltered tips feature HDPE barrier that won't contamina..
$45.00
1mL Racked Filtered Vertex Tips, Clear, Graduated, NoStick® (96 tips/rack)
Bestsellers
Features10uL to 1250uLClean Liquid ReleaseGraduatedFree of DNase, RNase, DNA and PCR inhibitorsFiltered tips feature HDPE barrier that won't contamina..
$35.00
UV/Vis Nano Spectrophotometer UV/Vis Nano Spectrophotometer
Bestsellers Special Offers
Nabi- UV/Vis Nano Spectrophotometer is a miniature spectrophotometer that can measure cuvette and microvolume samples. Using spectrometer technology, ..
$14,500.00