Menu
Your Cart
Solicite sus oligos online, al mejor precio y tiempo de entrega 48 hs Click here

100 μmCell Strainer, Faster membrane filter, yellow, sterile

100 μmCell Strainer, Faster membrane filter, yellow, sterile
Bestsellers
100 μmCell Strainer, Faster membrane filter, yellow, sterile

FAST Cell Strainer

Better choice for cell filtration and primary cell isolates

Features:

 

1.    Fits all standard 50 ml centrifuge tubes

2.    Stackable, three color for identification

3.    Faster and safer cell filtration

4.    Venting design on outside wall

5.    Extra handle for easy operation

6.    Individual plastic/paper wrapper

7.    Sterilized by Gamma, non-cytotoxic

 

Compared with regular cell strainer, Sorfa Fast Cell Strainer has features of faster and safer filtration for cell suspensions from tissue. At present, there are three mesh sizes for choices 40 μm, 70μm and 100μm. They fit all standard 50 ml centrifuge tubes.

 

With the design of circumferential mantle, cell strainer is able to fit centrifuge tube stably. Meanwhile, the mantle reduces the risk of contaminating during filtration of cell suspension. Each strainer has four vents on its inner wall surface for air exchange. Therefore, these vents insure stable filtration and avoid overspill of cell suspension when solution be filtered through membrane filter.

 

All Sorfa Fast Cell Strainers are sterilized by Gamma irradiation, non-cytotoxic and individually packed in plastic/paper wrapper.

 

Applications:

 

1.    Single cell suspensions of blood cells from marrow, pancreas, thymus, etc.

2.    Stem cells, tissue-derived cells, and cancer cells

3.    Preparation of specimens for primary cell cultures

4.    Preparation of freezing stocks

5.    Filtering agglutinative proteins produced in inactivation serum

Write a review

$2.18
  • Model SCS1002
  • Weight: 0.00kg
Betaine Solution 5 M (5 x 1 ml)
Most Viewed
Description:5M solution of betaine in MilliQ H2O. DNase, RNase free.Betaine is a PCR enhancing agent that has been used successfully for increasing yi..
$70.00
GelRed™ 10,000X in water (0.5 ml) GelRed™ 10,000X in water (0.5 ml)
Most Viewed Bestsellers
GelGreen™ is a sensitive, stable and environmentally safe green fluorescent nucleic acid dye designed to stain either dsDNA, ssDNA or RNA in agarose g..
$235.00
100 μmCell Strainer, Faster membrane filter, yellow, sterile
Bestsellers
FAST Cell StrainerBetter choice for cell filtration and primary cell isolatesFeatures: 1.    Fits all standard 50 ml centrifu..
$2.18
Ritips® evolution are engineered to provide universal syringes in line with the Ripette® pro as well as with most other dosing systems. Ritips® evolut..
$187.00
Assay 2 (E_Sarbeco) 1000 rxns
Bestsellers
E_Sarbeco_F1 ACAGGTACGTTAATAGTTAATAGCGTE_Sarbeco_R2 ATATTGCAGCAGTACGCACACAE_Sarbeco_P1 FAM-ACACTAGCCATCCTTACTGCGCTTCG-BHQ1..
$375.00
1 kb DNA ladder (50 ug)
Bestsellers
Serves as molecular weight standards for agarose gel electrophoresis. Suitable for sizing of PCR products or other double-stranded DNA fragments. Frag..
$63.00
100 bp DNA ladder (50 ug)
Bestsellers
Serves as molecular weight standards for electrophoresis for both agarose and polyacrylamide gels. Suitable for sizing of PCR products or other double..
$85.00
UV/Vis Nano Spectrophotometer UV/Vis Nano Spectrophotometer
Bestsellers Special Offers
Nabi- UV/Vis Nano Spectrophotometer is a miniature spectrophotometer that can measure cuvette and microvolume samples. Using spectrometer technology, ..
$14,500.00
TRI Reagent® (100 ml)
Bestsellers
TRI Reagent® is a patented reagent for the isolation of total RNA or for the simultaneous isolation of RNA, DNA and proteins. The reagent is an i..
$283.14
200uL Racked Filtered Vertex Tips, Clear, Graduated, NoStick® (96 tips/rack)
Bestsellers
Features10uL to 1250uLClean Liquid ReleaseGraduatedFree of DNase, RNase, DNA and PCR inhibitorsFiltered tips feature HDPE barrier that won't contamina..
$45.00
96 wells cell culture plate, treated, sterile (individually package) 96 wells cell culture plate, treated, sterile (individually package)
Bestsellers
Sorfa cell culture plates (also named tissue culture plates) are manufactured from raw materials of high transparency polystyrene in four different si..
$1.83
UV/Vis Nano Spectrophotometer UV/Vis Nano Spectrophotometer
Bestsellers Special Offers
Nabi- UV/Vis Nano Spectrophotometer is a miniature spectrophotometer that can measure cuvette and microvolume samples. Using spectrometer technology, ..
$14,500.00