Menu
Your Cart
Solicite sus oligos online, al mejor precio y tiempo de entrega 48 hs Click here

1.1 ml deep well plate, 96 square, v-bottom wells (5 units)

1.1 ml deep well plate, 96 square, v-bottom wells (5 units)
1.1 ml deep well plate, 96 square, v-bottom wells (5 units)
  • Ideal for sample collection, preparation, and long-term storage.
  • HTS-friendly—compatible with most liquid-handling robots.
  • SBS footprint meets ANSI/SLAS 1-2004.
  • Flatness tested for reliable automation performance.
  • Raised rims on each well facilitate secure sealing with films or sealing mats.
  • Optimum sample mixing and recovery through highly-polished wells with radiused corners.
  • Ultra-clear for easy visualization of samples.
  • Centrifugation to 4,000 RCF. 
  • Manufactured from virgin polypropylene to ensure complete sample recovery, chemical resistance, and compatibility with long-term storage needs.
  • Certified free of detectable DNase, RNase, DNA, and PCR inhibitors. Sterile plates are also pyrogen-free.
  • Bar coded plates available—contact SSIbio for details.
  • Alphanumeric indexing molded in on A-H and 1-12 axes.
  • Autoclavable. 
  • Stackable.

Write a review

$84.70
  • Model 775B-00
  • Weight: 0.00kg
Betaine Solution 5 M (5 x 1 ml)
Most Viewed
Description:5M solution of betaine in MilliQ H2O. DNase, RNase free.Betaine is a PCR enhancing agent that has been used successfully for increasing yi..
$70.00
GelRed™ 10,000X in water (0.5 ml) GelRed™ 10,000X in water (0.5 ml)
Most Viewed Bestsellers
GelGreen™ is a sensitive, stable and environmentally safe green fluorescent nucleic acid dye designed to stain either dsDNA, ssDNA or RNA in agarose g..
$235.00
Ideal for sample collection, preparation, and long-term storage.HTS-friendly—compatible with most liquid-handling robots.SBS footprint meets ANSI..
$84.70
Assay 3 (RNAse P) 1000 rxns
Bestsellers
RP-F RNAse P Forward AGATTTGGACCTGCGAGCG RP-R RNAse P Reverse GAGCGGCTGTCTCCACAAGT RP-P RNAse P FAM-TTCTGACCTGAAGGCTCTGCGCG-BHQ1  ..
$375.00
1 kb DNA ladder (50 ug)
Bestsellers
Serves as molecular weight standards for agarose gel electrophoresis. Suitable for sizing of PCR products or other double-stranded DNA fragments. Frag..
$63.00
100 bp DNA ladder (50 ug)
Bestsellers
Serves as molecular weight standards for electrophoresis for both agarose and polyacrylamide gels. Suitable for sizing of PCR products or other double..
$85.00
UV/Vis Nano Spectrophotometer UV/Vis Nano Spectrophotometer
Bestsellers Special Offers
Nabi- UV/Vis Nano Spectrophotometer is a miniature spectrophotometer that can measure cuvette and microvolume samples. Using spectrometer technology, ..
$14,500.00
Assay 1 (RdRRP) 1000 rxns
Bestsellers
RdRP_SARSr-F2 GTGARATGGTCATGTGTGGCGGRdRP_SARSr-R1 CARATGTTAAASACACTATTAGCATARdRP_SARSr-P2 FAM-CAGGTGGAACCTCATCAGGAGATGC-BHQ1(the above ..
$375.00
200uL Racked Filtered Vertex Tips, Clear, Graduated, NoStick® (96 tips/rack)
Bestsellers
Features10uL to 1250uLClean Liquid ReleaseGraduatedFree of DNase, RNase, DNA and PCR inhibitorsFiltered tips feature HDPE barrier that won't contamina..
$45.00
1mL Racked Filtered Vertex Tips, Clear, Graduated, NoStick® (96 tips/rack)
Bestsellers
Features10uL to 1250uLClean Liquid ReleaseGraduatedFree of DNase, RNase, DNA and PCR inhibitorsFiltered tips feature HDPE barrier that won't contamina..
$35.00
UV/Vis Nano Spectrophotometer UV/Vis Nano Spectrophotometer
Bestsellers Special Offers
Nabi- UV/Vis Nano Spectrophotometer is a miniature spectrophotometer that can measure cuvette and microvolume samples. Using spectrometer technology, ..
$14,500.00