Menu
Your Cart
Solicite sus oligos online, al mejor precio y tiempo de entrega 48 hs Click here

Bioprep-24 Homogenizer

Bioprep-24 Homogenizer
Bioprep-24 Homogenizer
Bioprep-24 Homogenizer
Special Offers
Bioprep-24 Homogenizer
Bioprep-24 Homogenizer
Bioprep-24 Homogenizer
Bioprep-24 Homogenizer
Fast, effective and reproducible homogenization of a wide range of samples, including tissues and cells hard to lyse. They also own extraordinary power for the processing of even impact resistant samples such as bones or cartiage. The Bioprep-6 and Bioprep-24 are ideal solutions for releasing DNA, RNA, Proteins, Enzymes, etc. from very tough samples while still retaining molecular integrity.
Using disposable sample tubes pre-filled with a varity of lysing beads, the Bioprep-24 vigorously and uniformly shakes the tubes providing an efficient, consistent, high-yield and quality homogenization usually in less than 35 seconds.
Typical Samples:  
-- Animal, Plant, Human cells;
-- Micro-organisms;
-- Drugs, polymers, lotions, etc.
-- Soil and sediments;
-- Swabs and feces
-- Bone, brain, tumors
-- Bacterial gram + or -
-- Yeast, fungi, spores
-- Seeds, roots
-- Feces, swabs
Applications: 
Any researcher who requires genomic DNA, RNA or recombinant protein as a starting material will benefit from the unit system.
-- Northern blot analysis, qPCR and microarrays
-- Oprimization of recombinant protein expression
-- Libray synthesis and Southern blots
-- Pathogen screening of soil or water
-- RT-PCR and differential display
-- Environmental surveys
-- Verefication of food safety
How to use beads
 
1.4mm&2.8mm Ceramic Beads
3mm&6mm Metal Beads
1mm&3mm Glass Beads
 Ideal for soft animal, plant or human tissues:
 • brain
 • liver
 • skin
 • leaves
 • gonad
 • muscle, etc.
 Ideal for any hard tissue types:
 • hair
 • teeth
 • bones
 • seeds
 • corn
 • rice
 • nail, etc
 Ideal for microorganisms Optimal for:
 • spores
 • fungi
 • yeast
 • e-coli, etc.
 We will offer the Lysing Kits which are available with Plastic or Stainless Steel pre-filled sample tubes in future
 
1. “3D Rotating High Speed Motion” for quick disruption of those fibrous tissues and resistant cells
2. 50 programmable memory settings and user optional condition settings
3. A wide range of rotation speed settings from 4 to 7 m/s, increment 0.05m/s
4. Brushless motor realizing no brush particle generation
5. Easy to remove sample tube holder and fix sample tubes
6. Easy to monitor the disruption process through the clear lid
7. Simultaneously homogenize:
   Bioprep-6 6*2ml tubes or 2*5ml tubes
   Bioprep-24 24*2ml tubes or 12*5ml tubes
8. Disposable tubes ensure no threat of cross-contamination or sample degradation
9. The Bioprep-6 and Bioprep-24 vigorously and uniformly shakes the tubes providing an efficient, consistent, highyield and quality homogenization usually in 35s or less
 Type Bioprep-24
 Display OLED
 Speed Range(m/s) 4.00m/s~7.00m/s, increment 0.05m/s
 Speed Range (rpm) 2430rpm -- 4260rpm, increment 10rpm
 Cycle Duration 1s -- 90s, increment 1s
 Pause time 1s -- 120s, increment 1s
 Cycle 10
 Programmable 50
 Samples 24 x 2ml/1.5ml/0.5ml or 12 x 5ml grinding tube
 Acceleration Time <4s
 Deceleration Time <4s
 Noise <70 db
 Power 500W
 Dimensions (W×D×H) 280×360×385 mm
 Weight (kg) 25.0 kg
 Power Supply AC100~240V, 50/60Hz

 

Write a review

$9,500.00
  • Model BIOPREP-24
  • Weight: 0.00kg
Betaine Solution 5 M (5 x 1 ml)
Most Viewed
Description:5M solution of betaine in MilliQ H2O. DNase, RNase free.Betaine is a PCR enhancing agent that has been used successfully for increasing yi..
$70.00
GelRed™ 10,000X in water (0.5 ml) GelRed™ 10,000X in water (0.5 ml)
Most Viewed Bestsellers
GelGreen™ is a sensitive, stable and environmentally safe green fluorescent nucleic acid dye designed to stain either dsDNA, ssDNA or RNA in agarose g..
$235.00
Bioprep-24 Homogenizer Bioprep-24 Homogenizer
Special Offers
Fast, effective and reproducible homogenization of a wide range of samples, including tissues and cells hard to lyse. They also own extraordinary powe..
$9,500.00
Assay 3 (RNAse P) 1000 rxns
Bestsellers
RP-F RNAse P Forward AGATTTGGACCTGCGAGCG RP-R RNAse P Reverse GAGCGGCTGTCTCCACAAGT RP-P RNAse P FAM-TTCTGACCTGAAGGCTCTGCGCG-BHQ1  ..
$375.00
The EZgrip® Carboys are designed to provide users with a highly versatile container that maximizes storage efficiency and ease of use. The distinctive..
$131.55
1 kb DNA ladder (50 ug)
Bestsellers
Serves as molecular weight standards for agarose gel electrophoresis. Suitable for sizing of PCR products or other double-stranded DNA fragments. Frag..
$63.00
100 bp DNA ladder (50 ug)
Bestsellers
Serves as molecular weight standards for electrophoresis for both agarose and polyacrylamide gels. Suitable for sizing of PCR products or other double..
$85.00
UV/Vis Nano Spectrophotometer UV/Vis Nano Spectrophotometer
Bestsellers Special Offers
Nabi- UV/Vis Nano Spectrophotometer is a miniature spectrophotometer that can measure cuvette and microvolume samples. Using spectrometer technology, ..
$14,500.00
TRI Reagent® (100 ml)
Bestsellers
TRI Reagent® is a patented reagent for the isolation of total RNA or for the simultaneous isolation of RNA, DNA and proteins. The reagent is an i..
$283.14
200uL Racked Filtered Vertex Tips, Clear, Graduated, NoStick® (96 tips/rack)
Bestsellers
Features10uL to 1250uLClean Liquid ReleaseGraduatedFree of DNase, RNase, DNA and PCR inhibitorsFiltered tips feature HDPE barrier that won't contamina..
$45.00
96 wells cell culture plate, treated, sterile (individually package) 96 wells cell culture plate, treated, sterile (individually package)
Bestsellers
Sorfa cell culture plates (also named tissue culture plates) are manufactured from raw materials of high transparency polystyrene in four different si..
$1.83
UV/Vis Nano Spectrophotometer UV/Vis Nano Spectrophotometer
Bestsellers Special Offers
Nabi- UV/Vis Nano Spectrophotometer is a miniature spectrophotometer that can measure cuvette and microvolume samples. Using spectrometer technology, ..
$14,500.00