Menu
Your Cart
Solicite sus oligos online, al mejor precio y tiempo de entrega 48 hs Click here

Thermo Shaker Incubator (0°C - 100 °C)

Thermo Shaker Incubator (0°C - 100 °C)
Thermo Shaker Incubator (0°C - 100 °C)
Thermo Shaker Incubator (0°C - 100 °C)
Bestsellers
Thermo Shaker Incubator (0°C - 100 °C)
Thermo Shaker Incubator (0°C - 100 °C)
Thermo Shaker Incubator (0°C - 100 °C)
Thermo Shaker Incubator (0°C - 100 °C)

Designed for simultaneous heating, cooling and mixing of small samples, MS-100 and MSC-100 can be supplied with interchangeable blocks for microtubes. Mixing, heating and cooling modes can be used either simultaneously or independently. The main body of the Mixing Block can be used with different kinds of blocks.

1. LCD display. It is easy to set up and use

2. Accurately control and display time, temperature and speed

3. Over-heating protection device ensures safety & reliability

4. Low noise working even under the speed of 1,500rpm

5. Conforms to CE safety standard

6. Peltier design of MSC-100 provides thermal control in a compact unit

7. Easy to replace the metal blocks and is very simple to clean and sterilize

 Model

 MS-100

 MSC-100

 Temperature Control Range

 RT+5°C~100°C

 0°C~100°C if Ambient temp.≤20°C

 4°C~100°C if Ambient temp.≤25°C

 10°C~100°C if Ambient temp.≤30°C

 Temperature Setting Range

 5°C~100°C

 0°C~100°C

 Timer

 1min~99h59min

 1min~99h59min

 Temp. Control Accuracy

 ±0.5°C

 ±0.5°C

 Display Accuracy

 ±0.1°C

 ±0.1°C

 Mixing Speed

 200~1500rpm*

 200~1500rpm

 Heating Time(25 to 100°C)

 ≤12min

 ≤15min

 Cooling Time

 ----

 ≤30min (from RT. to RT.-20°C)

 ≤15min (from 100°C to 20°C)

 Mixing Orbit

 2mm

 2mm

 Dimension(mm)

 300 x 220 x 175

 300 x 220 x 175

 Net Weight

 7kg

 8.5kg

Write a review

$1,768.00
  • Model MSC-100
  • Weight: 8.50kg
  • Dimensions (L x W x H): 30.00cm x 22.00cm x 18.00cm

Available Options

Betaine Solution 5 M (5 x 1 ml)
Most Viewed
Description:5M solution of betaine in MilliQ H2O. DNase, RNase free.Betaine is a PCR enhancing agent that has been used successfully for increasing yi..
$70.00
GelRed™ 10,000X in water (0.5 ml) GelRed™ 10,000X in water (0.5 ml)
Most Viewed Bestsellers
GelGreen™ is a sensitive, stable and environmentally safe green fluorescent nucleic acid dye designed to stain either dsDNA, ssDNA or RNA in agarose g..
$235.00
Thermo Shaker Incubator (0°C - 100 °C) Thermo Shaker Incubator (0°C - 100 °C)
Bestsellers
Designed for simultaneous heating, cooling and mixing of small samples, MS-100 and MSC-100 can be supplied with interchangeable blocks for microtube..
$1,768.00
http://www.fn-test.com/elisa/human/human-ca724tumor-marker-ca724/..
$1,016.40
The EZgrip® Carboys are designed to provide users with a highly versatile container that maximizes storage efficiency and ease of use. The distinctive..
$248.33
Assay 3 (RNAse P) 1000 rxns
Bestsellers
RP-F RNAse P Forward AGATTTGGACCTGCGAGCG RP-R RNAse P Reverse GAGCGGCTGTCTCCACAAGT RP-P RNAse P FAM-TTCTGACCTGAAGGCTCTGCGCG-BHQ1  ..
$375.00
1 kb DNA ladder (50 ug)
Bestsellers
Serves as molecular weight standards for agarose gel electrophoresis. Suitable for sizing of PCR products or other double-stranded DNA fragments. Frag..
$63.00
100 bp DNA ladder (50 ug)
Bestsellers
Serves as molecular weight standards for electrophoresis for both agarose and polyacrylamide gels. Suitable for sizing of PCR products or other double..
$85.00
UV/Vis Nano Spectrophotometer UV/Vis Nano Spectrophotometer
Bestsellers Special Offers
Nabi- UV/Vis Nano Spectrophotometer is a miniature spectrophotometer that can measure cuvette and microvolume samples. Using spectrometer technology, ..
$14,500.00
Assay 1 (RdRRP) 1000 rxns
Bestsellers
RdRP_SARSr-F2 GTGARATGGTCATGTGTGGCGGRdRP_SARSr-R1 CARATGTTAAASACACTATTAGCATARdRP_SARSr-P2 FAM-CAGGTGGAACCTCATCAGGAGATGC-BHQ1(the above ..
$375.00
200uL Racked Filtered Vertex Tips, Clear, Graduated, NoStick® (96 tips/rack)
Bestsellers
Features10uL to 1250uLClean Liquid ReleaseGraduatedFree of DNase, RNase, DNA and PCR inhibitorsFiltered tips feature HDPE barrier that won't contamina..
$45.00
1mL Racked Filtered Vertex Tips, Clear, Graduated, NoStick® (96 tips/rack)
Bestsellers
Features10uL to 1250uLClean Liquid ReleaseGraduatedFree of DNase, RNase, DNA and PCR inhibitorsFiltered tips feature HDPE barrier that won't contamina..
$35.00
UV/Vis Nano Spectrophotometer UV/Vis Nano Spectrophotometer
Bestsellers Special Offers
Nabi- UV/Vis Nano Spectrophotometer is a miniature spectrophotometer that can measure cuvette and microvolume samples. Using spectrometer technology, ..
$14,500.00