Menu
Your Cart
Solicite sus oligos online, al mejor precio y tiempo de entrega 48 hs Click here

-86°C ULT Freezer DW-86L828J

-86°C ULT Freezer DW-86L828J
-86°C ULT Freezer DW-86L828J

Most Energy Efficient

World leading power consumption, only 11.5 Kwh/day

Low Noise

Innovative refrigeration cabin design reduces operational noise

Reliable Performance

Cabinet temperature can reach -86℃ with temp uniformity within 5℃

Market Leading Energy Efficiency
High efficiency cooling fans and compressors combined with hydrocarbon refrigerants ensure energy savings and long term sample security
Multi Layered Sealing Structure
Triple of layer of gaskets split between main and inner doors decreases heat loss and guarantee’s excellent warm up times in the event of a power failure
Pressure Equalisation Port
Heated port with spring assisted mechanism to prevent icing on the vent allows users to reopen the main door soon after entering
Improved Handle Design
Lockable handle with unique key prevents other Haier freezer owners access to your precious samples, also comes with space for a padlock for that extra security
USB Interface
Enables users to download historical temperature data for compliance/auditing purposes
Multi Level Alarms
Alarming functions that include hi and low temperature, sensor error, power failure, high ambient, clean filter and door ajar



Write a review

$0.00
  • Model DW-86L828J
  • Weight: 0.00kg
Betaine Solution 5 M (5 x 1 ml)
Most Viewed
Description:5M solution of betaine in MilliQ H2O. DNase, RNase free.Betaine is a PCR enhancing agent that has been used successfully for increasing yi..
$70.00
GelRed™ 10,000X in water (0.5 ml) GelRed™ 10,000X in water (0.5 ml)
Most Viewed Bestsellers
GelGreen™ is a sensitive, stable and environmentally safe green fluorescent nucleic acid dye designed to stain either dsDNA, ssDNA or RNA in agarose g..
$235.00
Most Energy EfficientWorld leading power consumption, only 11.5 Kwh/dayLow NoiseInnovative refrigeration cabin design reduces operational noiseReliabl..
$0.00
Alternative for LN2 StorageUnique word-leading refrigeration system is designed by Haier to avoid the danger of traditional liquid nitrogen storage.Co..
$0.00
Most Energy EfficientWorld leading power consumption, only 11.5 Kwh/dayLow NoiseInnovative refrigeration cabin design reduces operational noiseReliabl..
$0.00
Assay 2 (E_Sarbeco) 1000 rxns
Bestsellers
E_Sarbeco_F1 ACAGGTACGTTAATAGTTAATAGCGTE_Sarbeco_R2 ATATTGCAGCAGTACGCACACAE_Sarbeco_P1 FAM-ACACTAGCCATCCTTACTGCGCTTCG-BHQ1..
$375.00
1 kb DNA ladder (50 ug)
Bestsellers
Serves as molecular weight standards for agarose gel electrophoresis. Suitable for sizing of PCR products or other double-stranded DNA fragments. Frag..
$63.00
100 bp DNA ladder (50 ug)
Bestsellers
Serves as molecular weight standards for electrophoresis for both agarose and polyacrylamide gels. Suitable for sizing of PCR products or other double..
$85.00
UV/Vis Nano Spectrophotometer UV/Vis Nano Spectrophotometer
Bestsellers Special Offers
Nabi- UV/Vis Nano Spectrophotometer is a miniature spectrophotometer that can measure cuvette and microvolume samples. Using spectrometer technology, ..
$14,500.00
TRI Reagent® (100 ml)
Bestsellers
TRI Reagent® is a patented reagent for the isolation of total RNA or for the simultaneous isolation of RNA, DNA and proteins. The reagent is an i..
$283.14
200uL Racked Filtered Vertex Tips, Clear, Graduated, NoStick® (96 tips/rack)
Bestsellers
Features10uL to 1250uLClean Liquid ReleaseGraduatedFree of DNase, RNase, DNA and PCR inhibitorsFiltered tips feature HDPE barrier that won't contamina..
$45.00
96 wells cell culture plate, treated, sterile (individually package) 96 wells cell culture plate, treated, sterile (individually package)
Bestsellers
Sorfa cell culture plates (also named tissue culture plates) are manufactured from raw materials of high transparency polystyrene in four different si..
$1.83
UV/Vis Nano Spectrophotometer UV/Vis Nano Spectrophotometer
Bestsellers Special Offers
Nabi- UV/Vis Nano Spectrophotometer is a miniature spectrophotometer that can measure cuvette and microvolume samples. Using spectrometer technology, ..
$14,500.00