Menu
Your Cart
Solicite sus oligos online, al mejor precio y tiempo de entrega 48 hs Click here

Carboy, 20L, Amber HDPE, 120mm Cap

Carboy, 20L, Amber HDPE, 120mm Cap
Carboy, 20L, Amber HDPE, 120mm Cap

The EZgrip® Carboys are designed to provide users with a highly versatile container that maximizes storage efficiency and ease of use. The distinctive rectangular shape saves valuable bench space. Larger handles on top of the container and molded grips in the base provide a full, secure grip to make lifting, handling, and pouring easy. The optional wide neck allows the user to reach inside the carboy for easier cleaning. Carboy material and volume are clearly imprinted on the outside of the bottle as well as large, easy to read, metric graduation marks which are certified to ±5% accuracy.

Amber HDPE carboys are made from a USP Class VI, FDA Grade material.

      

USP Class VIFDA ApprovedBPA FreeMade in the USA

Carboys
Carboy Material Amber HDPE
Cap Material Polypropylene
Approximate Capacity (max) 26.5L
Height (w/cap) 640mm
Height (w/o cap) 605mm
Length 345mm
Width 205mm

Write a review

$248.33
  • Model 15K-3121-OEM
  • Weight: 0.00kg
Betaine Solution 5 M (5 x 1 ml)
Most Viewed
Description:5M solution of betaine in MilliQ H2O. DNase, RNase free.Betaine is a PCR enhancing agent that has been used successfully for increasing yi..
$70.00
GelRed™ 10,000X in water (0.5 ml) GelRed™ 10,000X in water (0.5 ml)
Most Viewed Bestsellers
GelGreen™ is a sensitive, stable and environmentally safe green fluorescent nucleic acid dye designed to stain either dsDNA, ssDNA or RNA in agarose g..
$235.00
The EZgrip® Carboys are designed to provide users with a highly versatile container that maximizes storage efficiency and ease of use. The distinctive..
$248.33
Assay 3 (RNAse P) 1000 rxns
Bestsellers
RP-F RNAse P Forward AGATTTGGACCTGCGAGCG RP-R RNAse P Reverse GAGCGGCTGTCTCCACAAGT RP-P RNAse P FAM-TTCTGACCTGAAGGCTCTGCGCG-BHQ1  ..
$375.00
1 kb DNA ladder (50 ug)
Bestsellers
Serves as molecular weight standards for agarose gel electrophoresis. Suitable for sizing of PCR products or other double-stranded DNA fragments. Frag..
$63.00
100 bp DNA ladder (50 ug)
Bestsellers
Serves as molecular weight standards for electrophoresis for both agarose and polyacrylamide gels. Suitable for sizing of PCR products or other double..
$85.00
UV/Vis Nano Spectrophotometer UV/Vis Nano Spectrophotometer
Bestsellers Special Offers
Nabi- UV/Vis Nano Spectrophotometer is a miniature spectrophotometer that can measure cuvette and microvolume samples. Using spectrometer technology, ..
$14,500.00
Assay 1 (RdRRP) 1000 rxns
Bestsellers
RdRP_SARSr-F2 GTGARATGGTCATGTGTGGCGGRdRP_SARSr-R1 CARATGTTAAASACACTATTAGCATARdRP_SARSr-P2 FAM-CAGGTGGAACCTCATCAGGAGATGC-BHQ1(the above ..
$375.00
200uL Racked Filtered Vertex Tips, Clear, Graduated, NoStick® (96 tips/rack)
Bestsellers
Features10uL to 1250uLClean Liquid ReleaseGraduatedFree of DNase, RNase, DNA and PCR inhibitorsFiltered tips feature HDPE barrier that won't contamina..
$45.00
1mL Racked Filtered Vertex Tips, Clear, Graduated, NoStick® (96 tips/rack)
Bestsellers
Features10uL to 1250uLClean Liquid ReleaseGraduatedFree of DNase, RNase, DNA and PCR inhibitorsFiltered tips feature HDPE barrier that won't contamina..
$35.00
UV/Vis Nano Spectrophotometer UV/Vis Nano Spectrophotometer
Bestsellers Special Offers
Nabi- UV/Vis Nano Spectrophotometer is a miniature spectrophotometer that can measure cuvette and microvolume samples. Using spectrometer technology, ..
$14,500.00