Menu
Your Cart
Solicite sus oligos online, al mejor precio y tiempo de entrega 48 hs Click here

Maelstrom 9600

Maelstrom 9600
Maelstrom 9600
Maelstrom 9600
Maelstrom 9600
Maelstrom 9600
Maelstrom 9600
Maelstrom 9600
Maelstrom 9600
Maelstrom 9600
Maelstrom 9600 is an automated nucleic acid platform designed for high-throughput applications. Specialized spin tips enable efficient mixing of magnetic beads with a larger processing volume. With an intuitive user interface and flexible programming, Maelstrom 9600 can boost laboratory productivity by transforming routine operations into a walk-away solution. - High-throughput: 96 samples/run - Efficient whirl stir mixing approach - Speed and precision: 4 independent temperature control modules - Flexibility in samples/run: 6, 12, 18, 24, 32 up to 48 (with single tube) Model: Maelstrom 9600 Volume: 87 x 70 x 57.5 cm Power supply: 220-240 Vac Processing volume: 50ul - 1600ul Spin speed: up to 3000 rpm Magnetic rod: 3000 gauss Display: Touchscreen

Write a review

$0.00
  • Model MAE9600
  • Weight: 0.00kg
  • Dimensions (L x W x H): 87.00cm x 60.00cm x 57.00cm
Betaine Solution 5 M (5 x 1 ml)
Most Viewed
Description:5M solution of betaine in MilliQ H2O. DNase, RNase free.Betaine is a PCR enhancing agent that has been used successfully for increasing yi..
$70.00
GelRed™ 10,000X in water (0.5 ml) GelRed™ 10,000X in water (0.5 ml)
Most Viewed Bestsellers
GelGreen™ is a sensitive, stable and environmentally safe green fluorescent nucleic acid dye designed to stain either dsDNA, ssDNA or RNA in agarose g..
$235.00
Maelstrom 9600 is an automated nucleic acid platform designed for high-throughput applications. Specialized spin tips enable efficient mixing of magne..
$0.00
Assay 2 (E_Sarbeco) 1000 rxns
Bestsellers
E_Sarbeco_F1 ACAGGTACGTTAATAGTTAATAGCGTE_Sarbeco_R2 ATATTGCAGCAGTACGCACACAE_Sarbeco_P1 FAM-ACACTAGCCATCCTTACTGCGCTTCG-BHQ1..
$375.00
1 kb DNA ladder (50 ug)
Bestsellers
Serves as molecular weight standards for agarose gel electrophoresis. Suitable for sizing of PCR products or other double-stranded DNA fragments. Frag..
$63.00
100 bp DNA ladder (50 ug)
Bestsellers
Serves as molecular weight standards for electrophoresis for both agarose and polyacrylamide gels. Suitable for sizing of PCR products or other double..
$85.00
UV/Vis Nano Spectrophotometer UV/Vis Nano Spectrophotometer
Bestsellers Special Offers
Nabi- UV/Vis Nano Spectrophotometer is a miniature spectrophotometer that can measure cuvette and microvolume samples. Using spectrometer technology, ..
$14,500.00
Assay 1 (RdRRP) 1000 rxns
Bestsellers
RdRP_SARSr-F2 GTGARATGGTCATGTGTGGCGGRdRP_SARSr-R1 CARATGTTAAASACACTATTAGCATARdRP_SARSr-P2 FAM-CAGGTGGAACCTCATCAGGAGATGC-BHQ1(the above ..
$375.00
200uL Racked Filtered Vertex Tips, Clear, Graduated, NoStick® (96 tips/rack)
Bestsellers
Features10uL to 1250uLClean Liquid ReleaseGraduatedFree of DNase, RNase, DNA and PCR inhibitorsFiltered tips feature HDPE barrier that won't contamina..
$45.00
1mL Racked Filtered Vertex Tips, Clear, Graduated, NoStick® (96 tips/rack)
Bestsellers
Features10uL to 1250uLClean Liquid ReleaseGraduatedFree of DNase, RNase, DNA and PCR inhibitorsFiltered tips feature HDPE barrier that won't contamina..
$35.00
UV/Vis Nano Spectrophotometer UV/Vis Nano Spectrophotometer
Bestsellers Special Offers
Nabi- UV/Vis Nano Spectrophotometer is a miniature spectrophotometer that can measure cuvette and microvolume samples. Using spectrometer technology, ..
$14,500.00