Menu
Your Cart
Solicite sus oligos online, al mejor precio y tiempo de entrega 48 hs Click here

RNAzol®RT (100 ml)

RNAzol®RT (100 ml)
RNAzol®RT (100 ml)
RNAzol®RT (100 ml)
RNAzol®RT (100 ml)
RNAzol®RT (100 ml)
RNAzol®RT (100 ml)
RNAzol®RT (100 ml)

RNAzol® RT is the most effective reagent for isolation of total RNA and small RNA from samples of human, animal, plant, bacterial and viral origin. This patented reagent(1) provides higher yield and quality of isolated RNA than previous reagents based on the single-step method. RNAzol® RT isolates pure and undegraded RNA that is ready for RT-PCR without DNase treatment.(2)

  1. No chloroform-induced phase separation is necessary to obtain pure RNA. Just add water to remove DNA, proteins, polysaccharides and other contaminants.
  2. The isolation procedure can be completed in less than one hour and is performed at room temperature, including all centrifugation steps.
  3. RNAzol® RT isolates total RNA, or large RNA and small RNA in separate fractions. The large RNA fraction contains rRNA and mRNA. The small RNA fraction contains tRNA, small RNA and microRNA down to 10 bases.
  4. The isolated RNA is ready for RT-PCR, qRT-PCR, microarrays, poly A+ selection, northern blotting, RNase protection assay and other molecular biology applications.
  5. Due to the removal of impurities, the RNA pellets are smaller and solubilize more easily than pellets obtained from previous single-step reagents.
  6. In addition, RNAzol® RT allows for the simultaneous isolation of RNA and DNA.
  7. RNAzol® RT is used to isolate RNA from tissues, cells, liquid samples or blood. One milliliter is sufficient to process up to 100 mg tissue yielding 50 – 700 μg of large RNA (>200 bases) and 8 – 120μg of small RNA (200 – 10 bases)

Download User Manual

Write a review

$271.00
  • Model RN190100
  • Weight: 0.15kg
  • Dimensions (L x W x H): 5.00cm x 5.00cm x 10.00cm
Betaine Solution 5 M (5 x 1 ml)
Most Viewed
Description:5M solution of betaine in MilliQ H2O. DNase, RNase free.Betaine is a PCR enhancing agent that has been used successfully for increasing yi..
$70.00
GelRed™ 10,000X in water (0.5 ml) GelRed™ 10,000X in water (0.5 ml)
Most Viewed Bestsellers
GelGreen™ is a sensitive, stable and environmentally safe green fluorescent nucleic acid dye designed to stain either dsDNA, ssDNA or RNA in agarose g..
$235.00
RNAzol® RT is the most effective reagent for isolation of total RNA and small RNA from samples of human, animal, plant, bacterial and viral origin. Th..
$271.00
Assay 3 (RNAse P) 1000 rxns
Bestsellers
RP-F RNAse P Forward AGATTTGGACCTGCGAGCG RP-R RNAse P Reverse GAGCGGCTGTCTCCACAAGT RP-P RNAse P FAM-TTCTGACCTGAAGGCTCTGCGCG-BHQ1  ..
$375.00
Assay 2 (E_Sarbeco) 1000 rxns
Bestsellers
E_Sarbeco_F1 ACAGGTACGTTAATAGTTAATAGCGTE_Sarbeco_R2 ATATTGCAGCAGTACGCACACAE_Sarbeco_P1 FAM-ACACTAGCCATCCTTACTGCGCTTCG-BHQ1..
$375.00
1 kb DNA ladder (50 ug)
Bestsellers
Serves as molecular weight standards for agarose gel electrophoresis. Suitable for sizing of PCR products or other double-stranded DNA fragments. Frag..
$63.00
100 bp DNA ladder (50 ug)
Bestsellers
Serves as molecular weight standards for electrophoresis for both agarose and polyacrylamide gels. Suitable for sizing of PCR products or other double..
$85.00
UV/Vis Nano Spectrophotometer UV/Vis Nano Spectrophotometer
Bestsellers Special Offers
Nabi- UV/Vis Nano Spectrophotometer is a miniature spectrophotometer that can measure cuvette and microvolume samples. Using spectrometer technology, ..
$14,500.00
Assay 1 (RdRRP) 1000 rxns
Bestsellers
RdRP_SARSr-F2 GTGARATGGTCATGTGTGGCGGRdRP_SARSr-R1 CARATGTTAAASACACTATTAGCATARdRP_SARSr-P2 FAM-CAGGTGGAACCTCATCAGGAGATGC-BHQ1(the above ..
$375.00
200uL Racked Filtered Vertex Tips, Clear, Graduated, NoStick® (96 tips/rack)
Bestsellers
Features10uL to 1250uLClean Liquid ReleaseGraduatedFree of DNase, RNase, DNA and PCR inhibitorsFiltered tips feature HDPE barrier that won't contamina..
$45.00
1mL Racked Filtered Vertex Tips, Clear, Graduated, NoStick® (96 tips/rack)
Bestsellers
Features10uL to 1250uLClean Liquid ReleaseGraduatedFree of DNase, RNase, DNA and PCR inhibitorsFiltered tips feature HDPE barrier that won't contamina..
$35.00
UV/Vis Nano Spectrophotometer UV/Vis Nano Spectrophotometer
Bestsellers Special Offers
Nabi- UV/Vis Nano Spectrophotometer is a miniature spectrophotometer that can measure cuvette and microvolume samples. Using spectrometer technology, ..
$14,500.00