Menu
Your Cart
Solicite sus oligos online, al mejor precio y tiempo de entrega 48 hs Click here

UltraScript II RT (2000 u)

UltraScript II RT (2000 u)
UltraScript II RT (2000 u)

Ultra Script II Reverse Transcriptase (RNaseH Minus) is an engineered from Moloney Murine Leukemia Virus RT to reduce RNaseH activity and enhance cDNA yield. RnaUsScript RT is a single polypeptide chain with a molecular weight of approximately 78 kDa, is an RNA-dependent DNA polymerase that synthesizes the complementary cDNA strand from a single-stranded RNA template to which a primer has been annealed (1,2). RnaUsScript RT also efficiently extend   primers hybridized  to single-stranded DNA. This enzyme is expressed in E. coli (2) and purified to free of exogenous RNase activity, a common contaminant in commercial preparations of reverse transcriptase.The enzyme is used to synthesize first-strand cDNA up to 12 kb and 5X cDNA Synthesis buffer is provided.

Contents

  1. • Ultra Script II Reverse Transcriptase                                               10 ml
  2. • 5X cDNA Synthesis Buffer  {250 mM Tris-HCl(pH 8.3 at 25oC),
  3.   375 mM KCl, 15 mM MgCl250 mM DTT, and enhancer}           0.4 ml

Storage Buffer

20 mM Tris-HCl (pH 7.5), 100 mM NaCl, 0.1 mM EDTA, 1 mM DTT, 0.01% (v/v) NP40S, 50% (v/v)  glycerol

Download User Manual

RT-PCR
Format Reverse Transcriptase

Write a review

$90.00
  • Model PE5012
  • Weight: 0.00kg
Betaine Solution 5 M (5 x 1 ml)
Most Viewed
Description:5M solution of betaine in MilliQ H2O. DNase, RNase free.Betaine is a PCR enhancing agent that has been used successfully for increasing yi..
$70.00
GelRed™ 10,000X in water (0.5 ml) GelRed™ 10,000X in water (0.5 ml)
Most Viewed Bestsellers
GelGreen™ is a sensitive, stable and environmentally safe green fluorescent nucleic acid dye designed to stain either dsDNA, ssDNA or RNA in agarose g..
$235.00
Ultra Script II Reverse Transcriptase (RNaseH Minus) is an engineered from Moloney Murine Leukemia Virus RT to reduce RNaseH ac..
$90.00
Assay 3 (RNAse P) 1000 rxns
Bestsellers
RP-F RNAse P Forward AGATTTGGACCTGCGAGCG RP-R RNAse P Reverse GAGCGGCTGTCTCCACAAGT RP-P RNAse P FAM-TTCTGACCTGAAGGCTCTGCGCG-BHQ1  ..
$375.00
1 kb DNA ladder (50 ug)
Bestsellers
Serves as molecular weight standards for agarose gel electrophoresis. Suitable for sizing of PCR products or other double-stranded DNA fragments. Frag..
$63.00
100 bp DNA ladder (50 ug)
Bestsellers
Serves as molecular weight standards for electrophoresis for both agarose and polyacrylamide gels. Suitable for sizing of PCR products or other double..
$85.00
UV/Vis Nano Spectrophotometer UV/Vis Nano Spectrophotometer
Bestsellers Special Offers
Nabi- UV/Vis Nano Spectrophotometer is a miniature spectrophotometer that can measure cuvette and microvolume samples. Using spectrometer technology, ..
$14,500.00
TRI Reagent® (100 ml)
Bestsellers
TRI Reagent® is a patented reagent for the isolation of total RNA or for the simultaneous isolation of RNA, DNA and proteins. The reagent is an i..
$283.14
200uL Racked Filtered Vertex Tips, Clear, Graduated, NoStick® (96 tips/rack)
Bestsellers
Features10uL to 1250uLClean Liquid ReleaseGraduatedFree of DNase, RNase, DNA and PCR inhibitorsFiltered tips feature HDPE barrier that won't contamina..
$45.00
96 wells cell culture plate, treated, sterile (individually package) 96 wells cell culture plate, treated, sterile (individually package)
Bestsellers
Sorfa cell culture plates (also named tissue culture plates) are manufactured from raw materials of high transparency polystyrene in four different si..
$1.83
UV/Vis Nano Spectrophotometer UV/Vis Nano Spectrophotometer
Bestsellers Special Offers
Nabi- UV/Vis Nano Spectrophotometer is a miniature spectrophotometer that can measure cuvette and microvolume samples. Using spectrometer technology, ..
$14,500.00