Menu
Your Cart
Solicite sus oligos online, al mejor precio y tiempo de entrega 48 hs Click here

qScript XLT 1-Step RT-qPCR ToughMix (500 rxns) en 20 ul

qScript XLT 1-Step RT-qPCR ToughMix (500 rxns) en 20 ul
Bestsellers
qScript XLT 1-Step RT-qPCR ToughMix (500 rxns) en 20 ul

Features & Benefits

  • Tough Tested - Overcomes common inhibitors including polysaccharides, heme/hemoglobin, humic acid, melanin
  • Flexible - Use fast or standard qPCR cycling conditions
  • Broad dynamic range- Reliable data from your precious samples every time
  • Multiplexing enabled - Supports highly sensitive detection for up to four targets

 qScript XLT 1-Step RT-qPCR ToughMix is intended for molecular biology applications. This product is not intended for the diagnosis, prevention or treatment of a disease.

Description

qScript XLT One-Step RT-qPCR ToughMix is a ready-to-use, highly sensitive master mix for reverse transcription quantitative PCR (RT-qPCR) of RNA templates using hybridization probe detection chemistries such as TaqMan® 5'-hydrolysis probes. First-strand cDNA synthesis and subsequent PCR amplification are carried out seamlessly in the same reaction mixture with optimized 1-step thermal cycling parameters. This kit is ideal for highly sensitive quantification of RNA viruses or low abundance RNA targets as well as high throughput gene-expression studies. The system has been optimized to deliver maximum RT-PCR efficiency, sensitivity, and specificity in minimal reaction volumes and accelerated thermal cycling rates. The only necessary user-supplied materials for RT-qPCR is RNA sample and probe assay. It is compatible with all types of molecular probe assays including dual-labeling strategies. Elevating cDNA synthesis reaction temperature to 50-55°C during one-step RT-qPCR improves primer annealing and disruption of RNA secondary structure that can interfere with cDNA synthesis.
Content

2X concentrated One-Step Master Mix containing:

  • Reaction buffer with optimized concentrations of molecular-grade MgCl2, dATP, dCTP, dGTP, dTTP
  • qScript XLT reverse transcriptase
  • RNase inhibitor protein
  • AccuStart II Taq DNA Polymerase
  • Inert AccuVue™ plate loading dye
  • Proprietary enzyme stabilizers and performance-enhancing additives
  • Titrated reference dye (if applicable)
qRT- PCR
Chemistry TaqMan
Cycling Protocol Conventional
Instrument Compatibility No ROX
Multiplexing No
Tough Samples No

Write a review

$1,383.00
  • Model 95132-500
  • Weight: 0.05kg
  • Dimensions (L x W x H): 1.00cm x 8.00cm x 10.00cm
Betaine Solution 5 M (5 x 1 ml)
Most Viewed
Description:5M solution of betaine in MilliQ H2O. DNase, RNase free.Betaine is a PCR enhancing agent that has been used successfully for increasing yi..
$70.00
GelRed™ 10,000X in water (0.5 ml) GelRed™ 10,000X in water (0.5 ml)
Most Viewed Bestsellers
GelGreen™ is a sensitive, stable and environmentally safe green fluorescent nucleic acid dye designed to stain either dsDNA, ssDNA or RNA in agarose g..
$235.00
qScript XLT 1-Step RT-qPCR ToughMix (500 rxns) en 20 ul
Bestsellers
Features & BenefitsTough Tested - Overcomes common inhibitors including polysaccharides, heme/hemoglobin, humic acid, melaninFlexible - Use fast o..
$1,383.00
Assay 2 (E_Sarbeco) 1000 rxns
Bestsellers
E_Sarbeco_F1 ACAGGTACGTTAATAGTTAATAGCGTE_Sarbeco_R2 ATATTGCAGCAGTACGCACACAE_Sarbeco_P1 FAM-ACACTAGCCATCCTTACTGCGCTTCG-BHQ1..
$375.00
1 kb DNA ladder (50 ug)
Bestsellers
Serves as molecular weight standards for agarose gel electrophoresis. Suitable for sizing of PCR products or other double-stranded DNA fragments. Frag..
$63.00
100 bp DNA ladder (50 ug)
Bestsellers
Serves as molecular weight standards for electrophoresis for both agarose and polyacrylamide gels. Suitable for sizing of PCR products or other double..
$85.00
UV/Vis Nano Spectrophotometer UV/Vis Nano Spectrophotometer
Bestsellers Special Offers
Nabi- UV/Vis Nano Spectrophotometer is a miniature spectrophotometer that can measure cuvette and microvolume samples. Using spectrometer technology, ..
$14,500.00
Assay 1 (RdRRP) 1000 rxns
Bestsellers
RdRP_SARSr-F2 GTGARATGGTCATGTGTGGCGGRdRP_SARSr-R1 CARATGTTAAASACACTATTAGCATARdRP_SARSr-P2 FAM-CAGGTGGAACCTCATCAGGAGATGC-BHQ1(the above ..
$375.00
200uL Racked Filtered Vertex Tips, Clear, Graduated, NoStick® (96 tips/rack)
Bestsellers
Features10uL to 1250uLClean Liquid ReleaseGraduatedFree of DNase, RNase, DNA and PCR inhibitorsFiltered tips feature HDPE barrier that won't contamina..
$45.00
1mL Racked Filtered Vertex Tips, Clear, Graduated, NoStick® (96 tips/rack)
Bestsellers
Features10uL to 1250uLClean Liquid ReleaseGraduatedFree of DNase, RNase, DNA and PCR inhibitorsFiltered tips feature HDPE barrier that won't contamina..
$35.00
UV/Vis Nano Spectrophotometer UV/Vis Nano Spectrophotometer
Bestsellers Special Offers
Nabi- UV/Vis Nano Spectrophotometer is a miniature spectrophotometer that can measure cuvette and microvolume samples. Using spectrometer technology, ..
$14,500.00