Menu
Your Cart
Solicite sus oligos online, al mejor precio y tiempo de entrega 48 hs Click here

Assay 2 (E_Sarbeco) 1000 rxns

Assay 2 (E_Sarbeco) 1000 rxns
Bestsellers
Assay 2 (E_Sarbeco) 1000 rxns
E_Sarbeco_F1 ACAGGTACGTTAATAGTTAATAGCGT
E_Sarbeco_R2 ATATTGCAGCAGTACGCACACA
E_Sarbeco_P1 FAM-ACACTAGCCATCCTTACTGCGCTTCG-BHQ1

Write a review

$375.00
  • Model CRDPANE
  • Weight: 0.05kg
  • Dimensions (L x W x H): 1.00cm x 10.00cm x 17.00cm
Betaine Solution 5 M (5 x 1 ml)
Most Viewed
Description:5M solution of betaine in MilliQ H2O. DNase, RNase free.Betaine is a PCR enhancing agent that has been used successfully for increasing yi..
$70.00
GelRed™ 10,000X in water (0.5 ml) GelRed™ 10,000X in water (0.5 ml)
Most Viewed Bestsellers
GelGreen™ is a sensitive, stable and environmentally safe green fluorescent nucleic acid dye designed to stain either dsDNA, ssDNA or RNA in agarose g..
$235.00
Assay 2 (E_Sarbeco) 1000 rxns
Bestsellers
E_Sarbeco_F1 ACAGGTACGTTAATAGTTAATAGCGTE_Sarbeco_R2 ATATTGCAGCAGTACGCACACAE_Sarbeco_P1 FAM-ACACTAGCCATCCTTACTGCGCTTCG-BHQ1..
$375.00
1 kb DNA ladder (50 ug)
Bestsellers
Serves as molecular weight standards for agarose gel electrophoresis. Suitable for sizing of PCR products or other double-stranded DNA fragments. Frag..
$63.00
100 bp DNA ladder (50 ug)
Bestsellers
Serves as molecular weight standards for electrophoresis for both agarose and polyacrylamide gels. Suitable for sizing of PCR products or other double..
$85.00
UV/Vis Nano Spectrophotometer UV/Vis Nano Spectrophotometer
Bestsellers Special Offers
Nabi- UV/Vis Nano Spectrophotometer is a miniature spectrophotometer that can measure cuvette and microvolume samples. Using spectrometer technology, ..
$14,500.00
TRI Reagent® (100 ml)
Bestsellers
TRI Reagent® is a patented reagent for the isolation of total RNA or for the simultaneous isolation of RNA, DNA and proteins. The reagent is an i..
$283.14
200uL Racked Filtered Vertex Tips, Clear, Graduated, NoStick® (96 tips/rack)
Bestsellers
Features10uL to 1250uLClean Liquid ReleaseGraduatedFree of DNase, RNase, DNA and PCR inhibitorsFiltered tips feature HDPE barrier that won't contamina..
$45.00
96 wells cell culture plate, treated, sterile (individually package) 96 wells cell culture plate, treated, sterile (individually package)
Bestsellers
Sorfa cell culture plates (also named tissue culture plates) are manufactured from raw materials of high transparency polystyrene in four different si..
$1.83
UV/Vis Nano Spectrophotometer UV/Vis Nano Spectrophotometer
Bestsellers Special Offers
Nabi- UV/Vis Nano Spectrophotometer is a miniature spectrophotometer that can measure cuvette and microvolume samples. Using spectrometer technology, ..
$14,500.00