Menu
Your Cart
Solicite sus oligos online, al mejor precio y tiempo de entrega 48 hs Click here

Zeocin 5 gr (powder)

Zeocin 5 gr (powder)
Zeocin 5 gr (powder)

Write a review

$1,604.46
  • Model ant-zn-5p
  • Weight: 0.00kg
  • Dimensions (L x W x H): 6.30cm x 7.00cm x 2.70cm
Betaine Solution 5 M (5 x 1 ml)
Most Viewed
Description:5M solution of betaine in MilliQ H2O. DNase, RNase free.Betaine is a PCR enhancing agent that has been used successfully for increasing yi..
$70.00
GelRed™ 10,000X in water (0.5 ml) GelRed™ 10,000X in water (0.5 ml)
Most Viewed Bestsellers
GelGreen™ is a sensitive, stable and environmentally safe green fluorescent nucleic acid dye designed to stain either dsDNA, ssDNA or RNA in agarose g..
$235.00
Chemical Name : N-tris(Hydroxymethyl) Methyl GlycineCAS: 5704-04-1Molecular Formula : C6H13NO5Molecular Weight : 179.2 Structure : Prod..
$78.00
Assay 2 (E_Sarbeco) 1000 rxns
Bestsellers
E_Sarbeco_F1 ACAGGTACGTTAATAGTTAATAGCGTE_Sarbeco_R2 ATATTGCAGCAGTACGCACACAE_Sarbeco_P1 FAM-ACACTAGCCATCCTTACTGCGCTTCG-BHQ1..
$375.00
1 kb DNA ladder (50 ug)
Bestsellers
Serves as molecular weight standards for agarose gel electrophoresis. Suitable for sizing of PCR products or other double-stranded DNA fragments. Frag..
$63.00
100 bp DNA ladder (50 ug)
Bestsellers
Serves as molecular weight standards for electrophoresis for both agarose and polyacrylamide gels. Suitable for sizing of PCR products or other double..
$85.00
UV/Vis Nano Spectrophotometer UV/Vis Nano Spectrophotometer
Bestsellers Special Offers
Nabi- UV/Vis Nano Spectrophotometer is a miniature spectrophotometer that can measure cuvette and microvolume samples. Using spectrometer technology, ..
$14,500.00
Assay 1 (RdRRP) 1000 rxns
Bestsellers
RdRP_SARSr-F2 GTGARATGGTCATGTGTGGCGGRdRP_SARSr-R1 CARATGTTAAASACACTATTAGCATARdRP_SARSr-P2 FAM-CAGGTGGAACCTCATCAGGAGATGC-BHQ1(the above ..
$375.00
200uL Racked Filtered Vertex Tips, Clear, Graduated, NoStick® (96 tips/rack)
Bestsellers
Features10uL to 1250uLClean Liquid ReleaseGraduatedFree of DNase, RNase, DNA and PCR inhibitorsFiltered tips feature HDPE barrier that won't contamina..
$45.00
1mL Racked Filtered Vertex Tips, Clear, Graduated, NoStick® (96 tips/rack)
Bestsellers
Features10uL to 1250uLClean Liquid ReleaseGraduatedFree of DNase, RNase, DNA and PCR inhibitorsFiltered tips feature HDPE barrier that won't contamina..
$35.00
UV/Vis Nano Spectrophotometer UV/Vis Nano Spectrophotometer
Bestsellers Special Offers
Nabi- UV/Vis Nano Spectrophotometer is a miniature spectrophotometer that can measure cuvette and microvolume samples. Using spectrometer technology, ..
$14,500.00