Menu
Your Cart
Solicite sus oligos online, al mejor precio y tiempo de entrega 48 hs Click here

Ritips®evolution 1,0 ml (100 u)

Ritips®evolution 1,0 ml (100 u)
Ritips®evolution 1,0 ml (100 u)

Ritips® evolution are engineered to provide universal syringes in line with the Ripette® pro as well as with most other dosing systems. Ritips® evolution are compatible with several steppers for different applications. It is our target to offer you just one dosing system which works reliably and precisely for all your applications.

The Ritips® evolution consist of nine tip sizes for re- peated dispensing volumes, ranging from 1 ?l to 50 ml. Every single tip is subject to automated, individual testing to ensure 100 % reliable and repeat- able results.

Ritips® evolution are available in standard quality in packs of 25 and 100 pieces, respectively, as well as in bioclean® quality: sterile and single-wrapped. This can be confirmed by independent laboratories which certify that the tips are sterile and free from endotoxins, ATP, RNase and DNA impurities. Certificates for each batch are available on request, with lot number recorded on each box for full traceability.

 

Ritips® evolution are suitable for:
Ritter Ripette®, Ripette® pro and Ripette® genX, Biohit eLine ™-Dispenser, Brand HandyStep, HandyStep ® S and HandyStep electronic, EasyStep, Eppendorf Multipette® M4*, Multipette® stream, Multipette ® plus and Multipette® 4780, Gilson Repetman®, Minilab 100/101, STEPMATE Handrop. * without activated display

Write a review

$187.00
  • Model 40077 – 0004
  • Weight: 0.00kg
Betaine Solution 5 M (5 x 1 ml)
Most Viewed
Description:5M solution of betaine in MilliQ H2O. DNase, RNase free.Betaine is a PCR enhancing agent that has been used successfully for increasing yi..
$70.00
GelRed™ 10,000X in water (0.5 ml) GelRed™ 10,000X in water (0.5 ml)
Most Viewed Bestsellers
GelGreen™ is a sensitive, stable and environmentally safe green fluorescent nucleic acid dye designed to stain either dsDNA, ssDNA or RNA in agarose g..
$235.00
Ritips® evolution are engineered to provide universal syringes in line with the Ripette® pro as well as with most other dosing systems. Ritips® evolut..
$187.00
Assay 3 (RNAse P) 1000 rxns
Bestsellers
RP-F RNAse P Forward AGATTTGGACCTGCGAGCG RP-R RNAse P Reverse GAGCGGCTGTCTCCACAAGT RP-P RNAse P FAM-TTCTGACCTGAAGGCTCTGCGCG-BHQ1  ..
$375.00
1 kb DNA ladder (50 ug)
Bestsellers
Serves as molecular weight standards for agarose gel electrophoresis. Suitable for sizing of PCR products or other double-stranded DNA fragments. Frag..
$63.00
100 bp DNA ladder (50 ug)
Bestsellers
Serves as molecular weight standards for electrophoresis for both agarose and polyacrylamide gels. Suitable for sizing of PCR products or other double..
$85.00
UV/Vis Nano Spectrophotometer UV/Vis Nano Spectrophotometer
Bestsellers Special Offers
Nabi- UV/Vis Nano Spectrophotometer is a miniature spectrophotometer that can measure cuvette and microvolume samples. Using spectrometer technology, ..
$14,500.00
TRI Reagent® (100 ml)
Bestsellers
TRI Reagent® is a patented reagent for the isolation of total RNA or for the simultaneous isolation of RNA, DNA and proteins. The reagent is an i..
$283.14
200uL Racked Filtered Vertex Tips, Clear, Graduated, NoStick® (96 tips/rack)
Bestsellers
Features10uL to 1250uLClean Liquid ReleaseGraduatedFree of DNase, RNase, DNA and PCR inhibitorsFiltered tips feature HDPE barrier that won't contamina..
$45.00
96 wells cell culture plate, treated, sterile (individually package) 96 wells cell culture plate, treated, sterile (individually package)
Bestsellers
Sorfa cell culture plates (also named tissue culture plates) are manufactured from raw materials of high transparency polystyrene in four different si..
$1.83
UV/Vis Nano Spectrophotometer UV/Vis Nano Spectrophotometer
Bestsellers Special Offers
Nabi- UV/Vis Nano Spectrophotometer is a miniature spectrophotometer that can measure cuvette and microvolume samples. Using spectrometer technology, ..
$14,500.00