Brand: Scientific Specialties, Inc
Model: 4117NSFS
Features10uL to 1250uLClean Liquid ReleaseGraduatedFree of DNase, RNase, DNA and PCR inhibitorsFiltered tips feature HDPE barrier that won't contaminate or impede airflowLow RetentionAll SSI tips are produced to be naturally low retentive. However our Vertex NoStick tips offer users an even higher d..
$25.00
Brand: Sorfa
Model: T121-2
Sorfa centrifuge tubes are applicable in molecular biology as disposable laboratory consumables which are manufactured from high transparency polypropylene. Three types of volume are available to meet general need: 15 ml, 50 ml and 200 ml. A ring molded on inner surface of cap make an excellent seal..
$5.93
Brand: Sorfa
Model: T124-2
Sorfa centrifuge tubes are applicable in molecular biology as disposable laboratory consumables which are manufactured from high transparency polypropylene. Three types of volume are available to meet general need: 15 ml, 50 ml and 200 ml. A ring molded on inner surface of cap make an excellent seal..
$7.50
Brand: Genbiotech
Model: CRPANRD
RdRP_SARSr-F2 GTGARATGGTCATGTGTGGCGGRdRP_SARSr-R1 CARATGTTAAASACACTATTAGCATARdRP_SARSr-P2 FAM-CAGGTGGAACCTCATCAGGAGATGC-BHQ1(the above probe is specific for 2019-nCoV, will not detect SARS-CoV)..
$375.00
Brand: Genbiotech
Model: CRDPANE
E_Sarbeco_F1 ACAGGTACGTTAATAGTTAATAGCGTE_Sarbeco_R2 ATATTGCAGCAGTACGCACACAE_Sarbeco_P1 FAM-ACACTAGCCATCCTTACTGCGCTTCG-BHQ1..
$375.00
Brand: Genbiotech
Model: CRPANR
RP-F RNAse P Forward AGATTTGGACCTGCGAGCG RP-R RNAse P Reverse GAGCGGCTGTCTCCACAAGT RP-P RNAse P FAM-TTCTGACCTGAAGGCTCTGCGCG-BHQ1 ..
$375.00
Brand: Biotium
Model: 31001
EvaGreen® dye is a green fluorescent nucleic acid dye with features that make the dye useful for several applications including qPCR and DNA melt curve analysis, real-time monitoring of thermophilic helicase-dependent amplification (tHDA), and capillary gel electrophoresis. The dye is essentially no..
$108.00
Brand: Cleaver Scientific
Model: CV2
Variable Volume Single Channel PipettesSafety and comfortThe distinctive handle of these pipettes, with ejector push button located on the top of the finger rest, and the volume counter facing backwards, offer their user the sense of comfort and continuous control of the pipetting volume. OmniPETTE ..
$250.00
Brand: Quanta Biosciences
Model: 95057200
The qScript One-Step
SYBR Green RT-qPCR Kit is a convenient and highly sensitive solution for
quantitative RT-PCR of RNA templates (RT-qPCR) using SYBR Green I dye detection
and gene-specific primers. cDNA synthesis and PCR amplification are carried out
in the same tube without opening between p..
$1,608.00
Brand: Quanta Biosciences
Model: 95132-500
Features & BenefitsTough Tested - Overcomes common inhibitors including polysaccharides, heme/hemoglobin, humic acid, melaninFlexible - Use fast or standard qPCR cycling conditionsBroad dynamic range- Reliable data from your precious samples every timeMultiplexing enabled - Supports highly sensi..
$1,383.00
Brand: Ritter Medical
Model: 42001-0000
The Ripette® has been designed for dispensing precise volumes in long series. At the same time a high value has been set to make it ultra-robust and mechanically reliable by using only a minimum of moving parts. Due to its light weight (105 g) it is well-suitable for long dispensing series. The ergo..
$562.00
Brand: Ritter Medical
Model: 42020–0000
Ripette® pro is ergonomically the best choice by offering a high flexibility and handy features. It is furthermore designed and constructed for mechanical dispensing of highly precise dosage volumes systematically. Due to its mechanical construction, the Ripette® pro becomes low maintenance and requ..
$726.00
Brand: Ritter Medical
Model: 40077 – 0000
Ritips® evolution are engineered to provide universal syringes in line with the Ripette® pro as well as with most other dosing systems. Ritips® evolution are compatible with several steppers for different applications. It is our target to offer you just one dosing system which works reliably and pre..
$259.00
Brand: Ritter Medical
Model: 40077 – 0001
Ritips® evolution are engineered to provide universal syringes in line with the Ripette® pro as well as with most other dosing systems. Ritips® evolution are compatible with several steppers for different applications. It is our target to offer you just one dosing system which works reliably and pre..
$187.00
Brand: Ritter Medical
Model: 40077 – 0003
Ritips® evolution are engineered to provide universal syringes in line with the Ripette® pro as well as with most other dosing systems. Ritips® evolution are compatible with several steppers for different applications. It is our target to offer you just one dosing system which works reliably and pre..
$187.00
Brand: Ritter Medical
Model: 40077 – 0004
Ritips® evolution are engineered to provide universal syringes in line with the Ripette® pro as well as with most other dosing systems. Ritips® evolution are compatible with several steppers for different applications. It is our target to offer you just one dosing system which works reliably and pre..
$187.00
Brand: Ritter Medical
Model: 40077 – 0005
Ritips® evolution are engineered to provide universal syringes in line with the Ripette® pro as well as with most other dosing systems. Ritips® evolution are compatible with several steppers for different applications. It is our target to offer you just one dosing system which works reliably and pre..
$187.00
Brand: Ritter Medical
Model: 40077 – 0006
Ritips® evolution are engineered to provide universal syringes in line with the Ripette® pro as well as with most other dosing systems. Ritips® evolution are compatible with several steppers for different applications. It is our target to offer you just one dosing system which works reliably and pre..
$187.00
Brand: Ritter Medical
Model: 40077 – 0006
Ritips® evolution are engineered to provide universal syringes in line with the Ripette® pro as well as with most other dosing systems. Ritips® evolution are compatible with several steppers for different applications. It is our target to offer you just one dosing system which works reliably and pre..
$187.00
Brand: Geneaid
Model: SS1000-50
•No more suffering the false negative results and viral RNA degradation problem•Especially for Corona virus and Influenza virus MDxMultiple functions:(Collection, Inactivation, DNA/RNA stabilization, Shipping, and Storage)•Virus/bacteria killing•Nucleases inactivation•RNA stabilization•Sample long t..
$310.00
Brand: Genbiotech
Model: PE1010
Product
Description
Cloned Taq DNA Polymerase is expressed and
purified from E. coli that carries the Taq DNA Polymerase gene from Thermus
aquaticus. Taq DNA polymerase is a thermostable enzyme that catalyzes the
polymerization of nucleotides in the 5’-to-3’ direction at 70-74 ºC and
exhibit..
$40.00
Brand: Excel Scientific
Model: TS-RT2RR-100
Recommended temperature range: -40 to +120 °CFilm: polyester, 50 μm thick Adhesive: acrylic, 25 μm thick Properties: optically clear, 2 end tabsFor more information: www.excelscientifi c.com/thermalseal_content.html#RTAn economical fi lm with high optical clarity and low autofl uorescence suitable f..
$220.00
Brand: Excel Scientific
Model: TS-RT2-100
Recommended temperature range: -40 to +120 °CFilm: polyester, 50 μm thick Adhesive: acrylic, 25 μm thick Properties: optically clear, 2 end tabsFor more information: www.excelscientifi c.com/thermalseal_content.html#RTAn economical fi lm with high optical clarity and low autofl uorescence suitable f..
$245.00
Brand: Excel Scientific
Model: TSS-RTQ-100
Recommended temperature range: -70 to +100 °CFilm: polyolefi n, 50 μm thick Adhesive: silicone, 50 μm thick Properties: optically clear, chemical resistantThe silicone adhesive provides the strongest available seal, compatible with all PCR plates. For easy handling, the pressure-sensitive adhesive i..
$301.00
Brand: Allsheng
Model: MSC-100
Designed for simultaneous heating, cooling and mixing of
small samples, MS-100 and MSC-100 can be supplied with interchangeable blocks
for microtubes. Mixing, heating and cooling modes can be used either
simultaneously or independently. The main body of the Mixing Block can be used
with differen..
$1,768.00
Brand: Allsheng
Model: MS-100
Designed for simultaneous heating, cooling and mixing of
small samples, MS-100 and MSC-100 can be supplied with interchangeable blocks
for microtubes. Mixing, heating and cooling modes can be used either
simultaneously or independently. The main body of the Mixing Block can be used
with differen..
$1,243.00
Brand: Biosan
Model: TS-100C
Thermo–Shaker TS-100C provides intensive mixing and temperature control of samples in microtest tubes or PCR plate. This model of Thermo–Shaker differs from TS-100 with a possibility of cooling samples down to +4°C. Features of TS-100C meet the highest expectations of users accor..
$2,110.00
Brand: Scientific Specialties, Inc
Model: 3248-00
Angularly attached caps prevent cap lids and hinges from interfering with each other, allowing for easier operation in an SBS format rack.Robust interwell linkages make the tubes rigid, decreasing the chance of spillage.Unique two-material manufacturing creates the perfect environment for consistent..
$110.00
Brand: Scientific Specialties, Inc
Model: 3247-00
Angularly attached caps prevent cap lids and hinges from interfering with each other, allowing for easier operation in an SBS format rack.Robust interwell linkages make the tubes rigid, decreasing the chance of spillage.Unique two-material manufacturing creates the perfect environment for consistent..
$110.00
Brand: Genbiotech
Model: PE5012
Ultra Script II Reverse
Transcriptase (RNaseH Minus)
is an engineered from Moloney
Murine Leukemia Virus RT to reduce RNaseH activity and enhance cDNA
yield. RnaUsScript RT is a
single polypeptide chain with a molecular weight of approximately 78 kDa, is an&nb..
$90.00
Brand: Biosan
Model: BS-040102-AAA
DNA/RNA UV-cleaner box UVC/T-AR is designed for clean operations with DNA samples. UV-cleaner box provide protection against contamination.Model is a bench-top type, made of metal framework, plexiglas walls and working surface painted with powder enamel.UV-cleaner boxes are equipped with a..
$0.00
Brand: Biosan
Model: BS-040107-AAA
DNA/RNA UV-cleaner box UVT-S-AR is designed for clean operations with
DNA samples. UV-cleaner box provide protection against contamination.
Model is a bench-top type, made of metal framework,
glass walls, working surface made of stainless steel.
UV-cleaner boxes are equipped with a..
$0.00
Brand: Biosan
Model: BS-040104-AAA
DNA/RNA UV-cleaner box UVC/T-M-AR is designed for clean operations with DNA samples. UV--cleaner box provide protection against contamination.Model is a bench-top type, made of metal framework, glass walls, working surface made of stainless steel.UV-cleaner boxes are equipped with an open UV lamp in..
$0.00
Model: VERSA10HEPA
The VERSA 10 can be configured for
multiple applications including:·
qPCR
and PCR Set-up·
Sequencing
Reaction Set-up·
NGS
Library Normalization and Pooling· ..
$0.00
Brand: Geneaid
Model: VR300
Virus DNA/RNA Extraction Kit II VR050/VR100/VR300The Viral Nucleic Acid Extraction Kit II was designed specifically for efficient purification of viral DNA and viral RNA from cell-free samples such as serum, plasma, body fluids and the supernatant of viral infected cell cultures. The efficient glass..
$1,275.58
Brand: Scientific Specialties, Inc
Model: 4137NSFS
Features10uL to 1250uLClean Liquid ReleaseGraduatedFree of DNase, RNase, DNA and PCR inhibitorsFiltered tips feature HDPE barrier that won't contaminate or impede airflowLow RetentionAll SSI tips are produced to be naturally low retentive. However our Vertex NoStick tips offer users an even higher d..
$25.00
Brand: Genbiotech
Model: PE3009
HotStart Taq DNA Polymerase is a high purity, recombinant Taq DNA polymerase
preparation with high avidity monoclonal antibodies that bind the polymerase
and keep it inactive prior to the initial PCR denaturation step. Upon heat
activation (1 minute at 94°C),
the antibodies denature irreversibly..
$175.45
Brand: TanBead
Model: MAE2400
Maelstrom 2400 is an automated nucleic acid platform designed for applications with large volume requirements. Specialized spin tips enable efficient mixing of magnetic beads and have a larger processing volume. With an intuitive interface and flexible programs, Maelstrom 2400 can enable productivit..
$0.00