Menu
Your Cart
Solicite sus oligos online, al mejor precio y tiempo de entrega 48 hs Click here

COVID-19

Brand: Scientific Specialties, Inc Model: 4117NSFS
Features10uL to 1250uLClean Liquid ReleaseGraduatedFree of DNase, RNase, DNA and PCR inhibitorsFiltered tips feature HDPE barrier that won't contaminate or impede airflowLow RetentionAll SSI tips are produced to be naturally low retentive. However our Vertex NoStick tips offer users an even higher d..
$10.53
Brand: Sorfa Model: T121-2
Sorfa centrifuge tubes are applicable in molecular biology as disposable laboratory consumables which are manufactured from high transparency polypropylene. Three types of volume are available to meet general need: 15 ml, 50 ml and 200 ml. A ring molded on inner surface of cap make an excellent seal..
$5.93
Brand: Sorfa Model: T124-2
Sorfa centrifuge tubes are applicable in molecular biology as disposable laboratory consumables which are manufactured from high transparency polypropylene. Three types of volume are available to meet general need: 15 ml, 50 ml and 200 ml. A ring molded on inner surface of cap make an excellent seal..
$7.50
Brand: Genbiotech Model: CRPANRD
RdRP_SARSr-F2 GTGARATGGTCATGTGTGGCGGRdRP_SARSr-R1 CARATGTTAAASACACTATTAGCATARdRP_SARSr-P2 FAM-CAGGTGGAACCTCATCAGGAGATGC-BHQ1(the above probe is specific for 2019-nCoV, will not detect SARS-CoV)..
$375.00
Brand: Genbiotech Model: CRDPANE
E_Sarbeco_F1 ACAGGTACGTTAATAGTTAATAGCGTE_Sarbeco_R2 ATATTGCAGCAGTACGCACACAE_Sarbeco_P1 FAM-ACACTAGCCATCCTTACTGCGCTTCG-BHQ1..
$375.00
Brand: Genbiotech Model: CRPANR
RP-F RNAse P Forward AGATTTGGACCTGCGAGCG RP-R RNAse P Reverse GAGCGGCTGTCTCCACAAGT RP-P RNAse P FAM-TTCTGACCTGAAGGCTCTGCGCG-BHQ1  ..
$375.00
Showing 1 to 12 of 71 (6 Pages)