Menu
Your Cart
Solicite sus oligos online, al mejor precio y tiempo de entrega 48 hs Click here

Detection

Brand: Genbiotech Model: CRPANRD
RdRP_SARSr-F2 GTGARATGGTCATGTGTGGCGGRdRP_SARSr-R1 CARATGTTAAASACACTATTAGCATARdRP_SARSr-P2 FAM-CAGGTGGAACCTCATCAGGAGATGC-BHQ1(the above probe is specific for 2019-nCoV, will not detect SARS-CoV)..
$375.00
Brand: Genbiotech Model: CRDPANE
E_Sarbeco_F1 ACAGGTACGTTAATAGTTAATAGCGTE_Sarbeco_R2 ATATTGCAGCAGTACGCACACAE_Sarbeco_P1 FAM-ACACTAGCCATCCTTACTGCGCTTCG-BHQ1..
$375.00
Brand: Genbiotech Model: CRPANR
RP-F RNAse P Forward AGATTTGGACCTGCGAGCG RP-R RNAse P Reverse GAGCGGCTGTCTCCACAAGT RP-P RNAse P FAM-TTCTGACCTGAAGGCTCTGCGCG-BHQ1  ..
$375.00
Brand: Biotium Model: 31001
EvaGreen® dye is a green fluorescent nucleic acid dye with features that make the dye useful for several applications including qPCR and DNA melt curve analysis, real-time monitoring of thermophilic helicase-dependent amplification (tHDA), and capillary gel electrophoresis. The dye is essentially no..
$86.04
Brand: Quanta Biosciences Model: 95057200
The qScript One-Step SYBR Green RT-qPCR Kit is a convenient and highly sensitive solution for quantitative RT-PCR of RNA templates (RT-qPCR) using SYBR Green I dye detection and gene-specific primers. cDNA synthesis and PCR amplification are carried out in the same tube without opening between p..
$1,222.10
Brand: Quanta Biosciences Model: 95132-500
Features & BenefitsTough Tested - Overcomes common inhibitors including polysaccharides, heme/hemoglobin, humic acid, melaninFlexible - Use fast or standard qPCR cycling conditionsBroad dynamic range- Reliable data from your precious samples every timeMultiplexing enabled - Supports highly sensi..
$1,222.10
Brand: Quanta Biosciences Model: 95166-500
Features & Benefits4X concentrated master mix allows greater flexibility with dilute samples - as little as 1 pg of total RNAMultiplexing capable with up to 5 targetsTough-tested for applications where PCR inhibition from template impurities may be a concern, such as: crude extracts, c..
$1,862.00
Brand: Genbiotech Model: PE5012
Ultra Script II Reverse Transcriptase (RNaseH Minus) is an engineered from Moloney Murine Leukemia Virus RT to reduce RNaseH activity and enhance cDNA yield. RnaUsScript RT is a single polypeptide chain with a molecular weight of approximately 78 kDa, is an&nb..
$90.00
Brand: Genbiotech Model: PE3009
HotStart Taq DNA Polymerase is a high purity, recombinant Taq DNA polymerase preparation with high avidity monoclonal antibodies that bind the polymerase and keep it inactive prior to the initial PCR denaturation step. Upon heat activation (1 minute at 94°C), the antibodies denature irreversibly..
$175.45
Brand: Genbiotech Model: PD2002
dNTPs in Separate Tube contains 4 x 250 ul of dATP, dCTP, dGTP and dTTP (monosodium salt) at a concentration of 100 mM each in sterile deionized water at pH7.5, whose purity is up to 99.5 % (HPLC). It is free of RNAse and DNAse, and suitable for any molecular biology application that requi..
$145.20
Brand: Genbiotech Model: PE3011
RNasin is a ribonuclease inhibitor extracted from human placenta with a molecular weight 51kDa. It inhibits the activity of RNase by specially binding up to RNase with a non-covalent bond.  RNasin, free of RNase or Nickase, can   maintain its activity at pH from 5 to 8,..
$55.00
Showing 1 to 11 of 11 (1 Pages)