Menu
Your Cart
Solicite sus oligos online, al mejor precio y tiempo de entrega 48 hs Click here

MEM-H, Hanks' Salts Base, without L-Glutamine (500 ml)

MEM-H, Hanks' Salts Base, without L-Glutamine (500 ml)
MEM-H, Hanks' Salts Base, without L-Glutamine (500 ml)

MEM-Eagle is a modified form of MEM (Minimum Essential Medium). MEM is one of the most commonly used of all cell culture media. MEM can be used with a variety of suspension and adherent mammalian cells, including HeLa, fibroblasts, and primary rat astrocytes. Biological Industries offers a variety of MEM modifications for a wide range of cell culture applications. 

This MEM is modified as follows:

With

  • Hanks’ Salts
  • Sodium Bicarbonate
  • Phenol Red

Without:

  • L-Glutamine
Components Concentration (mg/L)
INORGANIC SALTS: 
Calcium Chloride (CaCl2) (Anhyd.) 140.00
Potassium Chloride (KCl) 400.00
Potassium Phosphate (KH2PO4) 60.00
Magnesium chloride-6H2O (MgCl2-H2O) 100.00
Magnesium Sulfate (MgSO4) (Anhydr.) 48.95
Sodium Chloride (NaCl) 8000.00
Sodium Bicarbonate (NaHCO3) 350.00
Sodium Phosphate (Na2HPO4) (Anhyd.) 47.88
OTHER COMPONENTS:
D-Glucose 1000.00
Phenol Red 10.00
AMINO ACIDS:
L-Arginine-HCl 126.00
L-Cystine 24.00
L-Histidine-HCl-H2O 42.00
L-Isoleucine 52.00
L-Leucine 52.00
L-Lysine-HCl 73.00
L-Methionine 15.00
L-Phenylalanine 32.00
L-Threonine 48.00
L-Tryptophan 10.00
L-Tyrosine 36.00
L-Valine 46.00
VITAMINS:
D-Ca Pantothenate 1.00
Choline Chloride 1.00
Folic Acid 1.00
i-Inositol 2.00
Niacinamide 1.00
Pyridoxal HCl 1.00
MEM
Type Hanks
Format Liquid
Glutamine No glutamine
Phenol Red Yes

Write a review

$62.92
  • Model 01-035-1A
  • Weight: 0.00kg
Ritips®evolution 5,0 ml (100 u)
Most Viewed
Ritips® evolution are engineered to provide universal syringes in line with the Ripette® pro as well as with most other dosing systems. Ritips® evolut..
$187.00
Ritips®evolution 2,5 ml (100 u)
Most Viewed
Ritips® evolution are engineered to provide universal syringes in line with the Ripette® pro as well as with most other dosing systems. Ritips® evolut..
$187.00
Ritips®evolution 5,0 ml (100 u)
Most Viewed
Ritips® evolution are engineered to provide universal syringes in line with the Ripette® pro as well as with most other dosing systems. Ritips® evolut..
$187.00
Ritips®evolution 1,0 ml (100 u)
Most Viewed
Ritips® evolution are engineered to provide universal syringes in line with the Ripette® pro as well as with most other dosing systems. Ritips® evolut..
$187.00
MEM-Eagle is a modified form of MEM (Minimum Essential Medium). MEM is one of the most commonly used of all cell culture media. MEM can be used w..
$62.92
Assay 2 (E_Sarbeco) 1000 rxns
Bestsellers
E_Sarbeco_F1 ACAGGTACGTTAATAGTTAATAGCGTE_Sarbeco_R2 ATATTGCAGCAGTACGCACACAE_Sarbeco_P1 FAM-ACACTAGCCATCCTTACTGCGCTTCG-BHQ1..
$375.00
MEM-Eagle is a modified form of MEM (Minimum Essential Medium). MEM is one of the most commonly used of all cell culture media. MEM can be used w..
$75.02
FAST Cell StrainerBetter choice for cell filtration and primary cell isolates Features: 1.    Fits all standard 50 ml ce..
$2.00
1 kb DNA ladder (50 ug)
Bestsellers
Serves as molecular weight standards for agarose gel electrophoresis. Suitable for sizing of PCR products or other double-stranded DNA fragments. Frag..
$63.00
100 bp DNA ladder (50 ug)
Bestsellers
Serves as molecular weight standards for electrophoresis for both agarose and polyacrylamide gels. Suitable for sizing of PCR products or other double..
$85.00
UV/Vis Nano Spectrophotometer UV/Vis Nano Spectrophotometer
Bestsellers Special Offers
Nabi- UV/Vis Nano Spectrophotometer is a miniature spectrophotometer that can measure cuvette and microvolume samples. Using spectrometer technology, ..
$14,500.00
Assay 1 (RdRRP) 1000 rxns
Bestsellers
RdRP_SARSr-F2 GTGARATGGTCATGTGTGGCGGRdRP_SARSr-R1 CARATGTTAAASACACTATTAGCATARdRP_SARSr-P2 FAM-CAGGTGGAACCTCATCAGGAGATGC-BHQ1(the above ..
$375.00
200uL Racked Filtered Vertex Tips, Clear, Graduated, NoStick® (96 tips/rack)
Bestsellers
Features10uL to 1250uLClean Liquid ReleaseGraduatedFree of DNase, RNase, DNA and PCR inhibitorsFiltered tips feature HDPE barrier that won't contamina..
$45.00
1mL Racked Filtered Vertex Tips, Clear, Graduated, NoStick® (96 tips/rack)
Bestsellers
Features10uL to 1250uLClean Liquid ReleaseGraduatedFree of DNase, RNase, DNA and PCR inhibitorsFiltered tips feature HDPE barrier that won't contamina..
$35.00
UV/Vis Nano Spectrophotometer UV/Vis Nano Spectrophotometer
Bestsellers Special Offers
Nabi- UV/Vis Nano Spectrophotometer is a miniature spectrophotometer that can measure cuvette and microvolume samples. Using spectrometer technology, ..
$14,500.00