Menu
Your Cart
Solicite sus oligos online, al mejor precio y tiempo de entrega 48 hs Click here

MultiSUB Maxi Duo

MultiSUB Maxi Duo
Bestsellers
MultiSUB Maxi Duo

The MultiSUB Maxi is primarily designed for resolution of high numbers of samples, such as from Cloning or PCR. The MultiSUB Maxi allows ultra high-resolution separations over extended runs. Tray sizes correspond to standard blotter sizes. It also allows easy sample transfer onto a membrane for further analysis.

Four gel tray sizes are available; 20 x 10cm, 20 x 15cm, 20 x 20cm and 20 x 25cm. Multichannel pipette compatible combs of up to 40 samples facilitate speed loading of up to 440 samples per gel. 50 sample combs allow maximum sample capacity of 550 samples per gel. Casting dams allow gels to be rapidly cast externally while the MultiSUB Maxi unit is in use for gel running.

Technical Specifications

Gel dimensions (w x l)

20 x 10cm, 20 x 20cm, 20 x 15cm, 20 x 25cm

Unit dimensions (w x l x h)

23 x 39.5 x 9cm

Max. sample capacity

20 x 10cm - 200 samples, 20 x 15cm - 350 samples, 20 x 20cm - 450 samples, 20 x 25cm - 550 samples

Buffer volume

1200ml

 

Combs available

No. of samples

1, 2, 4, 10, 16, 20MC, 25, 30, 36, 40MC, 50

Thicknesses

0.75, 1, 1.5, 2mm


Download User Manual

Horizontal Gel systems
Buffer volumen 1200 ml
Gel dimensions 20 x 10cm, 20 x 20cm, 20 x 15cm, 20 x 25cm
Max sample capacity 200 (20 x 10 tray), 350 (20 x 15 tray), 450 (20 x 20 tray), 550 (20 x 25 tray)

Write a review

$872.97
  • Model MSMAXIDUO
  • Weight: 0.00kg
Ritips®evolution 5,0 ml (100 u)
Most Viewed
Ritips® evolution are engineered to provide universal syringes in line with the Ripette® pro as well as with most other dosing systems. Ritips® evolut..
$187.00
Ritips®evolution 2,5 ml (100 u)
Most Viewed
Ritips® evolution are engineered to provide universal syringes in line with the Ripette® pro as well as with most other dosing systems. Ritips® evolut..
$187.00
Ritips®evolution 5,0 ml (100 u)
Most Viewed
Ritips® evolution are engineered to provide universal syringes in line with the Ripette® pro as well as with most other dosing systems. Ritips® evolut..
$187.00
Ritips®evolution 1,0 ml (100 u)
Most Viewed
Ritips® evolution are engineered to provide universal syringes in line with the Ripette® pro as well as with most other dosing systems. Ritips® evolut..
$187.00
MultiSUB Maxi Duo
Bestsellers
The MultiSUB Maxi is primarily designed for resolution of high numbers of samples, such as from Cloning or PCR. The MultiSUB Maxi allows ultra high-re..
$872.97
http://www.fn-test.com/elisa/horse/horse-tfpitissue-factor-pathway-inhibitor-elisa-kit-elisa-kit/..
$1,016.40
Assay 3 (RNAse P) 1000 rxns
Bestsellers
RP-F RNAse P Forward AGATTTGGACCTGCGAGCG RP-R RNAse P Reverse GAGCGGCTGTCTCCACAAGT RP-P RNAse P FAM-TTCTGACCTGAAGGCTCTGCGCG-BHQ1  ..
$375.00
1 kb DNA ladder (50 ug)
Bestsellers
Serves as molecular weight standards for agarose gel electrophoresis. Suitable for sizing of PCR products or other double-stranded DNA fragments. Frag..
$63.00
100 bp DNA ladder (50 ug)
Bestsellers
Serves as molecular weight standards for electrophoresis for both agarose and polyacrylamide gels. Suitable for sizing of PCR products or other double..
$85.00
UV/Vis Nano Spectrophotometer UV/Vis Nano Spectrophotometer
Bestsellers Special Offers
Nabi- UV/Vis Nano Spectrophotometer is a miniature spectrophotometer that can measure cuvette and microvolume samples. Using spectrometer technology, ..
$14,500.00
Assay 1 (RdRRP) 1000 rxns
Bestsellers
RdRP_SARSr-F2 GTGARATGGTCATGTGTGGCGGRdRP_SARSr-R1 CARATGTTAAASACACTATTAGCATARdRP_SARSr-P2 FAM-CAGGTGGAACCTCATCAGGAGATGC-BHQ1(the above ..
$375.00
200uL Racked Filtered Vertex Tips, Clear, Graduated, NoStick® (96 tips/rack)
Bestsellers
Features10uL to 1250uLClean Liquid ReleaseGraduatedFree of DNase, RNase, DNA and PCR inhibitorsFiltered tips feature HDPE barrier that won't contamina..
$45.00
1mL Racked Filtered Vertex Tips, Clear, Graduated, NoStick® (96 tips/rack)
Bestsellers
Features10uL to 1250uLClean Liquid ReleaseGraduatedFree of DNase, RNase, DNA and PCR inhibitorsFiltered tips feature HDPE barrier that won't contamina..
$35.00
UV/Vis Nano Spectrophotometer UV/Vis Nano Spectrophotometer
Bestsellers Special Offers
Nabi- UV/Vis Nano Spectrophotometer is a miniature spectrophotometer that can measure cuvette and microvolume samples. Using spectrometer technology, ..
$14,500.00