Menu
Your Cart
Solicite sus oligos online, al mejor precio y tiempo de entrega 48 hs Click here

Assay 2 (E_Sarbeco) 1000 rxns

Assay 2 (E_Sarbeco) 1000 rxns
Bestsellers
Assay 2 (E_Sarbeco) 1000 rxns
E_Sarbeco_F1 ACAGGTACGTTAATAGTTAATAGCGT
E_Sarbeco_R2 ATATTGCAGCAGTACGCACACA
E_Sarbeco_P1 FAM-ACACTAGCCATCCTTACTGCGCTTCG-BHQ1

Write a review

$375.00
  • Availability: In Stock
  • Model CRDPANE
  • Weight: 0.05kg
  • Dimensions (L x W x H): 1.00cm x 10.00cm x 17.00cm
Ritips®evolution 5,0 ml (100 u)
Most Viewed
Ritips® evolution are engineered to provide universal syringes in line with the Ripette® pro as well as with most other dosing systems. Ritips® evolut..
$187.00
Ritips®evolution 2,5 ml (100 u)
Most Viewed
Ritips® evolution are engineered to provide universal syringes in line with the Ripette® pro as well as with most other dosing systems. Ritips® evolut..
$187.00
Ritips®evolution 5,0 ml (100 u)
Most Viewed
Ritips® evolution are engineered to provide universal syringes in line with the Ripette® pro as well as with most other dosing systems. Ritips® evolut..
$187.00
Ritips®evolution 1,0 ml (100 u)
Most Viewed
Ritips® evolution are engineered to provide universal syringes in line with the Ripette® pro as well as with most other dosing systems. Ritips® evolut..
$187.00
Assay 2 (E_Sarbeco) 1000 rxns
Bestsellers
E_Sarbeco_F1 ACAGGTACGTTAATAGTTAATAGCGTE_Sarbeco_R2 ATATTGCAGCAGTACGCACACAE_Sarbeco_P1 FAM-ACACTAGCCATCCTTACTGCGCTTCG-BHQ1..
$375.00
1 kb DNA ladder (50 ug)
Bestsellers
Serves as molecular weight standards for agarose gel electrophoresis. Suitable for sizing of PCR products or other double-stranded DNA fragments. Frag..
$63.00
100 bp DNA ladder (50 ug)
Bestsellers
Serves as molecular weight standards for electrophoresis for both agarose and polyacrylamide gels. Suitable for sizing of PCR products or other double..
$85.00
UV/Vis Nano Spectrophotometer UV/Vis Nano Spectrophotometer
Bestsellers Special Offers 2-3 Days
Nabi- UV/Vis Nano Spectrophotometer is a miniature spectrophotometer that can measure cuvette and microvolume samples. Using spectrometer technology, ..
$14,500.00
Assay 1 (RdRRP) 1000 rxns
Bestsellers
RdRP_SARSr-F2 GTGARATGGTCATGTGTGGCGGRdRP_SARSr-R1 CARATGTTAAASACACTATTAGCATARdRP_SARSr-P2 FAM-CAGGTGGAACCTCATCAGGAGATGC-BHQ1(the above ..
$375.00
200uL Racked Filtered Vertex Tips, Clear, Graduated, NoStick® (96 tips/rack)
Bestsellers
Features10uL to 1250uLClean Liquid ReleaseGraduatedFree of DNase, RNase, DNA and PCR inhibitorsFiltered tips feature HDPE barrier that won't contamina..
$45.00
1mL Racked Filtered Vertex Tips, Clear, Graduated, NoStick® (96 tips/rack)
Bestsellers
Features10uL to 1250uLClean Liquid ReleaseGraduatedFree of DNase, RNase, DNA and PCR inhibitorsFiltered tips feature HDPE barrier that won't contamina..
$35.00
Biometra TOne Thermal Cycler Biometra TOne Thermal Cycler
Bestsellers Special Offers In Stock
Biometra TOne - Optimal Amplification Performance1.       Optimal price – performance ratio2.    &n..
$7,900.00
UV/Vis Nano Spectrophotometer UV/Vis Nano Spectrophotometer
Bestsellers Special Offers 2-3 Days
Nabi- UV/Vis Nano Spectrophotometer is a miniature spectrophotometer that can measure cuvette and microvolume samples. Using spectrometer technology, ..
$14,500.00